ID: 1190200557

View in Genome Browser
Species Human (GRCh38)
Location X:48357229-48357251
Sequence AAATGTAAGCAGAGGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190200557_1190200563 -1 Left 1190200557 X:48357229-48357251 CCCTCCAACCTCTGCTTACATTT No data
Right 1190200563 X:48357251-48357273 TTTGAAAGGGAATCTAAGTGTGG 0: 7
1: 0
2: 4
3: 21
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190200557 Original CRISPR AAATGTAAGCAGAGGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr