ID: 1190213471

View in Genome Browser
Species Human (GRCh38)
Location X:48466058-48466080
Sequence GCTCAGATTTGATGATGAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190213462_1190213471 19 Left 1190213462 X:48466016-48466038 CCTCGGGGTCCATGTACAGGAAG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1190213471 X:48466058-48466080 GCTCAGATTTGATGATGAACAGG 0: 1
1: 0
2: 1
3: 9
4: 196
1190213464_1190213471 10 Left 1190213464 X:48466025-48466047 CCATGTACAGGAAGGTGCCGATA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1190213471 X:48466058-48466080 GCTCAGATTTGATGATGAACAGG 0: 1
1: 0
2: 1
3: 9
4: 196
1190213469_1190213471 -7 Left 1190213469 X:48466042-48466064 CCGATAACCAGGGGGAGCTCAGA 0: 1
1: 1
2: 0
3: 18
4: 122
Right 1190213471 X:48466058-48466080 GCTCAGATTTGATGATGAACAGG 0: 1
1: 0
2: 1
3: 9
4: 196
1190213461_1190213471 20 Left 1190213461 X:48466015-48466037 CCCTCGGGGTCCATGTACAGGAA 0: 1
1: 0
2: 1
3: 8
4: 76
Right 1190213471 X:48466058-48466080 GCTCAGATTTGATGATGAACAGG 0: 1
1: 0
2: 1
3: 9
4: 196
1190213460_1190213471 21 Left 1190213460 X:48466014-48466036 CCCCTCGGGGTCCATGTACAGGA 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1190213471 X:48466058-48466080 GCTCAGATTTGATGATGAACAGG 0: 1
1: 0
2: 1
3: 9
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190213471 Original CRISPR GCTCAGATTTGATGATGAAC AGG Exonic
902129283 1:14244745-14244767 GGTGAGAATTGATGGTGAACAGG + Intergenic
903887786 1:26551088-26551110 GCTCAGACTGGCTGATTAACAGG + Intronic
904893155 1:33794406-33794428 GCTGAGTTTGGAAGATGAACTGG + Intronic
906007574 1:42489891-42489913 CATCAGATTTCATGATGAAGAGG - Intronic
908393901 1:63707647-63707669 GCCCAGTTTTGATGATAAATAGG + Intergenic
908904626 1:68993918-68993940 GCCCAGCTTTAATGATGAAGTGG + Intergenic
912656966 1:111495085-111495107 GCAAAGATTTCATGATGAAATGG + Intronic
917881484 1:179341286-179341308 GCTCGAATATAATGATGAACCGG - Exonic
921815931 1:219563363-219563385 GCTCAGCTTTGATGGTGACTGGG - Intergenic
923307144 1:232698688-232698710 GCTCAGGTTTGGTGATGTAATGG - Intergenic
923469950 1:234281666-234281688 GCTCAGTTTTGTTCTTGAACTGG + Intronic
1063463192 10:6227357-6227379 GGTCAGGTTTGTTGATGAGCCGG + Intronic
1064980563 10:21162333-21162355 CCTCAGATTTGATAATTAGCTGG - Intronic
1067028430 10:42864435-42864457 GCTCAGATCTTTTGATGATCTGG + Intergenic
1072447158 10:95509151-95509173 GTTCATATTTGGTGATGTACAGG - Intronic
1073556721 10:104460502-104460524 GCAAAGATTTCATGATGAAATGG - Intergenic
1075110768 10:119580252-119580274 GCTCAAATTTGAAGATTAATAGG + Intronic
1076511699 10:131018817-131018839 GCTTAGATTTGATCTTGACCCGG - Intergenic
1078319783 11:10323818-10323840 GCTCAGGTTAGATGATGAGAGGG + Intronic
1079675693 11:23223500-23223522 TCTCAGATTTGATAATGGACGGG - Intergenic
1080485975 11:32706929-32706951 GCTACGATCTGATTATGAACAGG - Intronic
1080855663 11:36109422-36109444 GCCAAGATTTGATGACAAACTGG + Intronic
1081158707 11:39727653-39727675 GCACAGATTGGATGAAGAATGGG + Intergenic
1088373479 11:109116280-109116302 GCTAAGAGTTGATGGAGAACAGG + Intergenic
1089681816 11:120122782-120122804 GTCCTGATGTGATGATGAACAGG - Intronic
1090585805 11:128211531-128211553 TCTTAGATTTGATGCTGAAGTGG - Intergenic
1090953162 11:131491837-131491859 GCTCAGATCTGGTGAAGATCTGG + Intronic
1094557532 12:31516544-31516566 GCTCAAATGTGATGAAGAAATGG - Intronic
1094767595 12:33615577-33615599 GCTCAAGTTTGATGAAAAACAGG + Intergenic
1096749101 12:53747545-53747567 GCTGAGATTTGATGATTACTGGG + Intergenic
1096953128 12:55496524-55496546 TCTTAGACTTGATCATGAACTGG - Intergenic
1099318107 12:81110073-81110095 GCTCATATTAGATGATCACCAGG + Intronic
1108540267 13:51437040-51437062 GCTAAGATTTCAGGATAAACTGG + Intronic
1110468212 13:75827479-75827501 GCTCAGCTATGAGGATGAAAAGG - Intronic
1112102654 13:96206899-96206921 GCAAAGATTTCATGATGAAAAGG + Intronic
1113127845 13:107000074-107000096 GATCTGCTTCGATGATGAACGGG - Intergenic
1117022443 14:51585243-51585265 ACTCAGATGTGGTGAGGAACTGG - Intronic
1117274287 14:54176743-54176765 GAACAGAATTGATGATGAAATGG - Intergenic
1122680817 14:103461122-103461144 GCTAAGAGTTGATGATGATTTGG + Intronic
1124049965 15:26187812-26187834 TCTCAGATTTGATGATTTACTGG - Intergenic
1124897780 15:33793073-33793095 ACTCAGATTTGATAATTCACTGG + Intronic
1127398253 15:58560886-58560908 TCTCAGTTTGGTTGATGAACTGG - Exonic
1128420519 15:67487741-67487763 GCTCAGATTTCTTGATAAAGTGG + Intronic
1128431334 15:67597411-67597433 GCTGAGCTATGATGTTGAACTGG + Intronic
1130346115 15:83047026-83047048 GCTGATATTTGTTGATTAACTGG - Intronic
1130374892 15:83320136-83320158 ACTCAGAATTGAGGATGAAATGG + Intergenic
1131745308 15:95441015-95441037 GATCGTATTTGATGATGAAGAGG - Intergenic
1132948274 16:2545000-2545022 TCTCGGATGTGATGATGAAGAGG - Intronic
1133450413 16:5899410-5899432 GCTGAGACTGAATGATGAACAGG + Intergenic
1133646498 16:7769617-7769639 GCTTAGATTTGCTGAGGAATAGG + Intergenic
1134205943 16:12237948-12237970 GGTCAGATTTCATGATGCAGTGG + Intronic
1135845593 16:25915579-25915601 GGTCTGATATGATGATGGACAGG - Intronic
1136050222 16:27644950-27644972 GCTCAGATTTGTGCATGGACAGG + Intronic
1143205294 17:5136606-5136628 GCTCTGATTTCATGATGGGCTGG + Intronic
1143406640 17:6682134-6682156 GCTCTCAGCTGATGATGAACAGG + Intergenic
1143892629 17:10114386-10114408 GCTCAGATTTGCAGAGGACCAGG - Intronic
1144876341 17:18399299-18399321 GCTCTGATTTCATGATGGGCTGG + Intergenic
1145155886 17:20545121-20545143 GCTCTGATTTCATGATGGGCTGG - Intergenic
1145760989 17:27425440-27425462 GCTCTGATTTCATGATGGGCTGG + Intergenic
1145808003 17:27748315-27748337 GCTCAGATTTCAAGGTGAGCAGG + Intergenic
1146811133 17:35904324-35904346 GCTTAGGTTTGATGAAGAATGGG + Intergenic
1146843338 17:36169186-36169208 GCTCTGATTTCATGATGGGCTGG - Intronic
1146855647 17:36257127-36257149 GCTCTGATTTCATGATGGGCTGG - Intronic
1146864974 17:36331248-36331270 GCTCTGATTTCATGATGGGCTGG + Intronic
1146871553 17:36381038-36381060 GCTCTGATTTCATGATGGGCTGG - Intronic
1146878912 17:36432120-36432142 GCTCTGATTTCATGATGGGCTGG - Intronic
1146882852 17:36453266-36453288 GCTCTGATTTCATGATGGGCTGG - Intergenic
1147067833 17:37931842-37931864 GCTCTGATTTCATGATGGGCTGG + Intronic
1147074439 17:37981662-37981684 GCTCTGATTTCATGATGGGCTGG - Intronic
1147079364 17:38011397-38011419 GCTCTGATTTCATGATGGGCTGG + Intronic
1147085962 17:38061201-38061223 GCTCTGATTTCATGATGGGCTGG - Intronic
1147095304 17:38135339-38135361 GCTCTGATTTCATGATGGGCTGG + Intergenic
1147101907 17:38185166-38185188 GCTCTGATTTCATGATGGGCTGG - Intergenic
1147536475 17:41325664-41325686 GCTCTGATTTCATGATGGGCTGG + Intergenic
1149673064 17:58432911-58432933 GATAAGATTTGCTGATGGACTGG + Intronic
1151837487 17:76592646-76592668 GCTTAAATTTGAATATGAACCGG + Intergenic
1155705437 18:28804859-28804881 GCTCAGAGAAGATGATGGACAGG - Intergenic
1157736635 18:50055267-50055289 GCTCAGACTGGAGGATGAAACGG - Exonic
1159501716 18:69279858-69279880 TGTCAGATTTGATGTTGAAGTGG - Intergenic
1160375252 18:78406489-78406511 GCTCGGTTTTCATGATGAGCAGG + Intergenic
1161008446 19:1948111-1948133 GCTCAGACTTGATCCTGCACCGG + Intronic
1161085047 19:2331129-2331151 GCTCAGATCTGCTGAGGAGCGGG - Intronic
1162190972 19:8946539-8946561 ACTCAGATTTGGAGATAAACTGG + Exonic
1162191069 19:8947409-8947431 GCTCAAATTTGGAGATGAACTGG + Exonic
1162191309 19:8949158-8949180 GCTCAAATTTGGGGGTGAACTGG + Exonic
1162191548 19:8950910-8950932 GCTCAAATTTGGAGGTGAACTGG + Exonic
1162191664 19:8951792-8951814 GCTCAAATTTGAAGTGGAACTGG + Exonic
1162191884 19:8953529-8953551 GCTCAAACTTGAAGATGAACTGG + Exonic
1162192133 19:8955302-8955324 GCTCAGCTTTGGAGGTGAACTGG + Exonic
1162192250 19:8956187-8956209 GCTCAAATTTGGAGGTGAACTGG + Exonic
1162192834 19:8960582-8960604 GCTCAAATTTGGAGGTGAACTGG + Exonic
1163762657 19:19145940-19145962 GCTCAGACTTGATGCTGACTGGG + Exonic
925677743 2:6383422-6383444 GCTGGGATTTGATGATTATCCGG + Intergenic
925770100 2:7273897-7273919 GTACAGGTTTGATGAGGAACAGG + Intergenic
925784897 2:7422455-7422477 GCTCAGATTTTATTTTGAAAGGG - Intergenic
925925022 2:8663997-8664019 GCTCAGAATTGATGGTCATCTGG - Intergenic
926039881 2:9664500-9664522 GCTAAGCTTTAATGATGAAGTGG + Intergenic
926190366 2:10723105-10723127 GCTGAGGTTTGAGGATGGACGGG + Intronic
927539655 2:23897403-23897425 GTAGAGATTTGATGAGGAACAGG - Intronic
927830702 2:26347163-26347185 GCTAAGATGTGAAGATGAACGGG - Intronic
928090669 2:28372754-28372776 GGCGAGATTTGATGAGGAACAGG + Intergenic
928377474 2:30787402-30787424 GCTCACATTTGATGATGCAAAGG - Intronic
928665312 2:33545612-33545634 GCACAGATTTCATAATGAAGAGG - Intronic
928966971 2:36986374-36986396 TATCTGATTTGATGATTAACTGG - Intronic
930826171 2:55699163-55699185 GATCAGACTTGCTGATGAATTGG + Intergenic
931904573 2:66828742-66828764 CTCCAGATTTGATGGTGAACAGG + Intergenic
931932493 2:67155518-67155540 GCAGAGATATGATGATGAGCAGG + Intergenic
933952702 2:87343941-87343963 GCTCAGATCTTTTGATGATCCGG - Intergenic
934236944 2:90240287-90240309 GCTCAGATCTTTTGATGATCCGG - Intergenic
934796815 2:97108403-97108425 GCTCAGACATGATTATGAAGAGG - Intergenic
934836604 2:97595030-97595052 GCTCAGACATGATTATGAAGAGG + Intergenic
936545198 2:113386413-113386435 GCTCAGACATGATTATGAAGAGG - Intergenic
943198925 2:184793771-184793793 GCTCAGCTATGAGGATGAAAAGG - Intronic
943214133 2:185008665-185008687 GCTGAGATTTAATAAGGAACAGG - Intergenic
944567632 2:201006654-201006676 GGTCATATATGATGATGAACTGG + Intronic
948644857 2:239398078-239398100 GCTCAGAATTGATGACTAGCTGG - Intronic
948670273 2:239564136-239564158 GCTCAGAAATGAGAATGAACAGG + Intergenic
949071975 2:242030874-242030896 GATCAGATCTGGTGTTGAACTGG - Intergenic
1171106693 20:22440231-22440253 GCTCAGATTGGGGGATGAGCTGG - Intergenic
1173307262 20:41862408-41862430 GGTGAGATTAGGTGATGAACTGG + Intergenic
1175328697 20:58147988-58148010 GCTCTGATTTGATGGTGAGATGG - Intergenic
1175609977 20:60342696-60342718 TCTCAGATTGGATAATGAAGGGG - Intergenic
1175711124 20:61221946-61221968 GATGAGATTCCATGATGAACGGG + Intergenic
1177653966 21:23992842-23992864 GCACAGATTTGATGAAAAAAGGG + Intergenic
1184691743 22:46120404-46120426 GCTCAGACGTGATTATGAAGGGG + Intergenic
950917002 3:16656256-16656278 GCTTAGATTTGATGAAGAGTGGG + Intronic
952223683 3:31351792-31351814 GCTCTGACATGATGATGCACTGG - Intergenic
954380317 3:50215753-50215775 GCTCAGACTTGATGATGTACAGG - Exonic
954870411 3:53763479-53763501 ACTAAGACTTGCTGATGAACTGG - Intronic
964814626 3:160703672-160703694 GCTCAGATCTGATTATTAAGTGG + Intergenic
965158720 3:165101043-165101065 GCTCTGAGTTCCTGATGAACTGG - Intergenic
965810462 3:172586610-172586632 TCTCAGATTTGATAAGGAAGTGG + Intergenic
966098885 3:176242370-176242392 GCCCAGTTTTGATGATAAATGGG - Intergenic
971577006 4:28287254-28287276 GCTAAGATCTGAGGATGAAAAGG + Intergenic
971890328 4:32511405-32511427 GCTGAGATTTGATGAAAAAATGG - Intergenic
975970589 4:80030173-80030195 GCTAAGATTTGTTGATAGACTGG + Intronic
978853086 4:113361616-113361638 TCTTAGATTTGGTGATGAATAGG + Intronic
981347183 4:143689823-143689845 GCTAAGATATGATGATGCAAAGG + Intronic
981943641 4:150315234-150315256 ACTCAGACTTGTTGATGAGCAGG - Intronic
982036099 4:151347429-151347451 GATCAGAGTCTATGATGAACTGG + Intergenic
982118843 4:152119751-152119773 GGTCAAACTTGATGATGAAGAGG - Intergenic
982719923 4:158848914-158848936 GCTTAGATTTGATGAAGGAGTGG + Intronic
983871794 4:172832291-172832313 GTTCAGCTTTGTTGATGATCTGG - Intronic
985508084 5:296209-296231 GATCAGATCTGGTGTTGAACTGG - Intronic
985739951 5:1609460-1609482 GATCAGATCTGGTGTTGAACTGG + Intergenic
986470347 5:8067624-8067646 GAGCAGATTTGATAAAGAACAGG + Intergenic
990017227 5:51078607-51078629 GCTCATATGTGATGATAGACAGG - Intergenic
990599841 5:57347142-57347164 GCTCAGTCATGATGATGATCTGG + Intergenic
992222227 5:74584366-74584388 GATAAGATTTGGTGATTAACTGG - Intergenic
992833327 5:80616689-80616711 GCTTAGATTCGATGAAGAATGGG + Intergenic
994593430 5:101802056-101802078 GCTCAGATATGATATTCAACAGG - Intergenic
995418195 5:111933689-111933711 TCTCAGACTTGCTGATGAATTGG - Intronic
996618503 5:125470797-125470819 TTTCAGATTTGAAGATGGACAGG + Intergenic
996653001 5:125904361-125904383 GCTTAGGTTTGATGATAAATGGG + Intergenic
999773327 5:154791876-154791898 GGTTAGATGAGATGATGAACAGG - Intronic
1000577617 5:162994213-162994235 GATCAGATTTGATATTGACCAGG - Intergenic
1002698750 5:181107954-181107976 GCTTAGATATGGTGATGAAGTGG + Intergenic
1002949619 6:1796536-1796558 GCTCAGATTTGATGCTGTTTTGG + Intronic
1004149322 6:13100249-13100271 GCTTAGGTTTGATGAAGAAGTGG + Intronic
1004491639 6:16122808-16122830 GTTCAGATTTGCTGGAGAACAGG + Intergenic
1006251288 6:32788246-32788268 GCAAAGATTTCATGATGAAGAGG + Intergenic
1009338117 6:62519031-62519053 AATAAGATTTGATGATCAACTGG - Intergenic
1009902796 6:69829339-69829361 TCTCACATTCCATGATGAACAGG + Intergenic
1011577179 6:88815427-88815449 CCTCAGATTTGATAATTCACTGG - Intronic
1012362984 6:98406617-98406639 GCTCAGATTTCATGGTAACCTGG + Intergenic
1012629699 6:101449559-101449581 GCTTAGGTTTGATGAAGAAGTGG + Intronic
1017700443 6:157064423-157064445 GCTCAGTTTTTATGATGATACGG + Intronic
1021936439 7:25636672-25636694 GCTCAGATTGGATGGAGAATGGG - Intergenic
1022430298 7:30312513-30312535 GCCCAGATTTGAAGATGAAGTGG - Intronic
1023373871 7:39537179-39537201 GAACAGATTGGATGATGTACTGG - Intergenic
1027865138 7:83636852-83636874 GCTCAGTCTTGAACATGAACAGG - Intronic
1030960868 7:115920463-115920485 GCACATATTTGATGATGGAGAGG + Intergenic
1031701113 7:124928173-124928195 GGTGAGAGTTGATGATGATCTGG - Intronic
1036077074 8:5513872-5513894 GCTCAGGTTTGGTGGTGAATGGG + Intergenic
1036752236 8:11450738-11450760 GCTCAGATTTGAGCAAGGACAGG - Intronic
1037677317 8:21062648-21062670 GATCTGAACTGATGATGAACTGG - Intergenic
1039818790 8:41118212-41118234 GCTCTGATTTAATGAAGGACTGG - Intergenic
1042483885 8:69331174-69331196 GATCAGATCTGGTGTTGAACTGG - Intergenic
1043488754 8:80726409-80726431 GGGGAGATTTGAAGATGAACTGG + Intronic
1046168330 8:110470377-110470399 GCTCAGATATGAGGATGCAAAGG - Intergenic
1046830680 8:118742499-118742521 GCTGAGAATTGAAGATGAAGAGG + Intergenic
1047340913 8:123979722-123979744 CTTCAGTTTTGATGATGAAGTGG + Intronic
1047938200 8:129802252-129802274 GATCAGATTTGAGGGTGATCAGG + Intergenic
1055647057 9:78371254-78371276 GCTCAGCTTTTATGAGCAACTGG - Intergenic
1058242269 9:102579545-102579567 GGTGAGATGTGATGCTGAACTGG + Intergenic
1058505204 9:105659630-105659652 GCTAAGAATTCATGGTGAACTGG - Intergenic
1062630378 9:137460622-137460644 GCTCAGACTTGGTGAGGAGCTGG - Exonic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1186901229 X:14059032-14059054 GGTCAGATTTCATGAGGAAAAGG + Intergenic
1187788683 X:22923162-22923184 GCTCAGATATGATTACGAAGCGG - Intergenic
1188094896 X:26009285-26009307 GCTCAGAGTTTATGTGGAACTGG - Intergenic
1189861115 X:45273518-45273540 GCTTAGGTTTGATGAAGAATGGG + Intergenic
1190213471 X:48466058-48466080 GCTCAGATTTGATGATGAACAGG + Exonic
1191871220 X:65747192-65747214 GCTCAGATTAGGTGATGAATTGG - Intergenic
1192733204 X:73821885-73821907 GAGCAGATTTGATGATAAAAAGG + Intergenic
1193325146 X:80171820-80171842 GCTGACATTTGGTGATCAACAGG + Intergenic
1194279547 X:91932221-91932243 GCTCAGCTTTGGTCAAGAACAGG - Intronic
1194736248 X:97515557-97515579 GCTTAGGTTTGATGAAGAAGTGG + Intronic
1195240692 X:102949056-102949078 GCTCAGATTTCATGCTGTCCCGG - Intergenic
1195347834 X:103968275-103968297 GCTCAGATTTGCTCATTACCGGG + Intergenic
1195359608 X:104070566-104070588 GCTCAGATTTGCTCATTACCGGG - Intergenic
1195740058 X:108055758-108055780 GCTGAGTTTTAATGATGAATGGG - Intronic
1196065049 X:111454896-111454918 GCAAAGATTTTATGATGAAGAGG + Intergenic
1197679255 X:129364659-129364681 TCTCTCATTTCATGATGAACAGG - Intergenic
1198571127 X:137958408-137958430 GCTGACATTTGATGTTCAACAGG + Intergenic
1199846832 X:151697707-151697729 GCTCTGGTTTGATGACTAACTGG - Intronic
1200321790 X:155197280-155197302 GCTCAAATTTCCTGAGGAACAGG - Intronic