ID: 1190215420

View in Genome Browser
Species Human (GRCh38)
Location X:48476621-48476643
Sequence CCGCCTGGAGGGGTACCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190215405_1190215420 28 Left 1190215405 X:48476570-48476592 CCAGTAGACGGGGTGGATTCGAG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1190215420 X:48476621-48476643 CCGCCTGGAGGGGTACCCGGTGG 0: 1
1: 0
2: 1
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190215420 Original CRISPR CCGCCTGGAGGGGTACCCGG TGG Intronic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
910292923 1:85616364-85616386 CCGCCTGGAGGGTCGCCGGGAGG - Intergenic
916174197 1:162023990-162024012 TCGGGCGGAGGGGTACCCGGCGG + Intergenic
916674386 1:167053906-167053928 GCACCTGGAGGGGCACCAGGTGG - Exonic
918332095 1:183471352-183471374 CCGCCTGGACGGGGTCCCTGAGG - Intergenic
920504723 1:206507784-206507806 GCGCCCGGAGGGCTGCCCGGGGG + Exonic
920808426 1:209257261-209257283 CCGCCGTGAGGGGTACAAGGGGG - Intergenic
922003421 1:221503975-221503997 CCTCCTGGAGGTGGACCCGACGG - Intergenic
922499065 1:226083579-226083601 CCGCGTGGGGGCGGACCCGGTGG - Intergenic
1076247408 10:128958271-128958293 CCGCCTGAATGGGAACCCCGAGG - Intergenic
1076351079 10:129815771-129815793 CCACATGGAGGGGTCCCTGGAGG + Intergenic
1077469080 11:2748432-2748454 CTGCCTGGGGAGGTACCCAGGGG - Intronic
1089352398 11:117828966-117828988 CCGCCTGGTGGGGCTCCCTGTGG - Intronic
1089365496 11:117918657-117918679 CGGCCTGGAGGTGTACCAGCTGG + Exonic
1093027737 12:14260085-14260107 GGGCCTGGCGGGGTACCAGGAGG + Intergenic
1103800447 12:123534027-123534049 GCGCTTGGGGGGGTACCCCGGGG - Intergenic
1104997650 12:132668601-132668623 CCGCCTGGGTGGGCACTCGGTGG - Intronic
1107323327 13:39212291-39212313 CCGCCTGGAGGGGTCTCAGAGGG - Intergenic
1113197310 13:107823501-107823523 GAGCCTGGAGGGGTACGCAGAGG - Intronic
1113437996 13:110307734-110307756 CCGCATGCAGGGGTGACCGGAGG - Intronic
1114452600 14:22836961-22836983 CCGCCGGGAGGCGAGCCCGGGGG + Intronic
1127532422 15:59857435-59857457 CAGCTTGGAGGGGTGCCCAGTGG + Intergenic
1128338875 15:66805990-66806012 CAGTCTGGAGGGGTTCCTGGAGG - Intergenic
1131394734 15:92077415-92077437 CCGCCTGTAGGAGGACACGGCGG - Intronic
1132683139 16:1152091-1152113 CAGCCTGGAGGGGTGCCCTGGGG + Intergenic
1134024313 16:10942441-10942463 CCACCGGGAGGGCTACGCGGCGG - Exonic
1138418343 16:56884240-56884262 CCGCCTGCATGGCTACCCTGGGG - Intronic
1139670746 16:68491239-68491261 CAGCCTGGATGGGCTCCCGGAGG + Intergenic
1143480662 17:7225962-7225984 CTGACTGGAGGGGCCCCCGGAGG + Exonic
1147183527 17:38701885-38701907 CCGCCTGGGCGGGGACCCGCTGG - Intergenic
1148079547 17:44960131-44960153 CCGCCCGGAGGGGACCCCGGCGG + Exonic
1152064794 17:78104879-78104901 CAGCCGGGAGGGGTCCCGGGAGG - Exonic
1160174084 18:76579071-76579093 CCGCTCGGAGGGGCGCCCGGGGG + Intergenic
1160750159 19:730184-730206 CCGCCTGGAGGGCTTCCTGCAGG - Intronic
1160948120 19:1652670-1652692 CCGCCGGGCGGGGCACTCGGGGG - Intergenic
1161313317 19:3606787-3606809 CGGCCTGGAGGGGTCCGCGGGGG + Intronic
1162919244 19:13890384-13890406 CCTCCTGGAGGGGGACCCCCAGG + Exonic
925922235 2:8645597-8645619 CCGCCTGGGGAGGAACCCAGAGG + Intergenic
938573594 2:132584482-132584504 AAGCCTGGAGAGGTACCCAGAGG + Intronic
946386631 2:219387860-219387882 CGGCCTGAAGGGGCACGCGGGGG - Exonic
948455360 2:238102149-238102171 CCGCCTGGGGGGGCAGCCTGGGG + Intronic
948944191 2:241211178-241211200 CAGCCTGGAGGGGGGCCCTGTGG - Intronic
1169867543 20:10217805-10217827 CAGCCTGCACGGGTACCCCGGGG + Intergenic
1173752388 20:45487502-45487524 TCCCCTGGAGGGGCAGCCGGTGG - Intergenic
1174207033 20:48847782-48847804 CTGACTGGAAGGGGACCCGGGGG - Intergenic
1175795872 20:61770302-61770324 CTGCCTGGAGGGGCAGCCTGTGG + Intronic
1179961255 21:44768064-44768086 CTGCCTGGTGATGTACCCGGGGG - Intergenic
1181269747 22:21652235-21652257 TCGTCTGGACGGGGACCCGGGGG + Intergenic
1181557089 22:23677420-23677442 CGGCCAGGAGGGGTACCCTTTGG - Intergenic
1181571754 22:23771757-23771779 TAGCCTGGAGGGGTCCCCAGGGG + Intronic
1185178436 22:49345336-49345358 ACACCTGGAGCCGTACCCGGCGG + Intergenic
954288253 3:49634929-49634951 CAGCCTGCAGGGGTAGCGGGTGG + Intronic
961340374 3:126213282-126213304 CGGCCTGGAGGGAGACCCGGCGG + Intergenic
964865519 3:161255363-161255385 CAGCTTGGAGGGGTACCCACTGG - Intergenic
997859511 5:137403795-137403817 CAGCTTGGAGGGGTAACAGGAGG + Intronic
999326650 5:150648272-150648294 CAGCATGGAGGGGTACTCAGAGG + Exonic
1003145449 6:3506359-3506381 CCGCCTGGAGGGGTGGCCCTAGG + Intergenic
1006170058 6:32087385-32087407 CCGCCTGCAGAGGGCCCCGGCGG - Intronic
1020290970 7:6721947-6721969 CCTCCTGGAGGGGTACCCTGAGG + Intergenic
1026787870 7:73313163-73313185 CCACGGGCAGGGGTACCCGGGGG + Exonic
1029606902 7:101604733-101604755 CAGCCTGGAGGGCTTCCTGGAGG - Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1034478071 7:151300173-151300195 CCACCAGGAGGGGCACCCTGTGG + Intergenic
1035126065 7:156608252-156608274 CGGCCTGGAGGGGAAGCGGGTGG - Intergenic
1038040554 8:23720544-23720566 CAGGCAGGAGGGGGACCCGGGGG + Intergenic
1040734646 8:50490860-50490882 CCGCCTTGAGGAGGACCTGGCGG - Intronic
1057996336 9:99823977-99823999 CCACCGGGAGGGGAACACGGGGG + Intronic
1060313612 9:122487710-122487732 CTGCCTGGATGGGAACCCAGGGG + Intergenic
1062035508 9:134380916-134380938 CTGCTGGGAGGGGTTCCCGGGGG - Intronic
1062194285 9:135264307-135264329 CCGCCTGGATGGGCACACGAGGG + Intergenic
1186096561 X:6108831-6108853 CAGCCTGGAGGGCTTCCCAGGGG - Intronic
1186436467 X:9547200-9547222 CAGCCTGGAGGGGTTCCCACTGG - Intronic
1190215420 X:48476621-48476643 CCGCCTGGAGGGGTACCCGGTGG + Intronic
1190337345 X:49270299-49270321 CCTCCCGGAGCGGTCCCCGGGGG + Exonic
1200835385 Y:7726896-7726918 CAGCCGGGAGGGGTGCCTGGGGG + Intergenic
1201313675 Y:12621619-12621641 GCGCCTGGAGGTGTGCCCAGCGG - Intergenic