ID: 1190216195

View in Genome Browser
Species Human (GRCh38)
Location X:48481098-48481120
Sequence GAAGATGCACAGAGCCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190216192_1190216195 16 Left 1190216192 X:48481059-48481081 CCTGGAAAATGTATTTAGTGTCT 0: 1
1: 1
2: 0
3: 29
4: 314
Right 1190216195 X:48481098-48481120 GAAGATGCACAGAGCCAGATGGG 0: 1
1: 0
2: 1
3: 23
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190216195 Original CRISPR GAAGATGCACAGAGCCAGAT GGG Intronic
900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG + Intronic
901339157 1:8479611-8479633 GAAGATGAGCAGAGAAAGATGGG + Intronic
901819092 1:11814709-11814731 GAAGAGGCACAGATTCAGCTTGG - Intronic
902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG + Intergenic
902703952 1:18191657-18191679 GCAGAAAAACAGAGCCAGATGGG - Intronic
903273654 1:22207711-22207733 GCAGCTGCCCAGAGCCAGATTGG + Intergenic
903447786 1:23433367-23433389 GCAGAAGGAAAGAGCCAGATTGG - Intronic
903695852 1:25206421-25206443 AAAGACACACAGAGCAAGATGGG + Intergenic
903897559 1:26618387-26618409 GAAGCTGCAGTGAGCCAGGTTGG - Intergenic
904322966 1:29708532-29708554 AGAGATGCCCAGAGCCAGATGGG - Intergenic
904858556 1:33518112-33518134 GAAGAGTCACAGAGCCAGCCAGG - Intronic
904920470 1:34003951-34003973 GAGTCTGCACAGAGCCACATGGG - Intronic
905516167 1:38563583-38563605 GAAGGGGCACAGCCCCAGATAGG + Intergenic
906366630 1:45215546-45215568 AAAGAAGCACAGAGCCAGATAGG - Intronic
907659712 1:56380771-56380793 GAAGTTGAGCAGAACCAGATCGG + Intergenic
908679338 1:66642183-66642205 GAAGCTGCACAGCGGGAGATGGG - Intronic
909024041 1:70462876-70462898 AAAGTTGCACAGAGCCATGTGGG - Intergenic
909085691 1:71167702-71167724 GAAGCTGCACAGATCCTGCTTGG + Intergenic
911666216 1:100556219-100556241 GAAGATGCAGAGAGAGAGATTGG - Intergenic
915299092 1:154941855-154941877 GAGGAGGCACAGGGCCAGACAGG + Intergenic
915482954 1:156199677-156199699 GGGGATTGACAGAGCCAGATTGG + Intronic
916644000 1:166764081-166764103 GAAGGAGCAAACAGCCAGATGGG + Intergenic
918081596 1:181211869-181211891 AAACATGGACACAGCCAGATGGG - Intergenic
920651804 1:207843118-207843140 GAAGCTGCAGAGAGTAAGATGGG + Intergenic
920971488 1:210746957-210746979 GAAGATTCCCAAAGCCAGAGAGG - Intronic
921925325 1:220706217-220706239 GAAGATGCCCAGATTCAGCTAGG - Intergenic
922963111 1:229664894-229664916 GAGGATGCAGAGAGCCAGCGGGG - Intergenic
923178640 1:231494612-231494634 GAAGATGCACAGGAACTGATAGG - Intergenic
1063440757 10:6071020-6071042 AAAGATGCATAGAGCCTCATTGG - Intergenic
1063503383 10:6574853-6574875 GAAGTGGCAGTGAGCCAGATGGG - Intronic
1064265558 10:13822637-13822659 GGTGCTGCACAGAGCCAGATGGG + Intronic
1065815625 10:29480183-29480205 GAAGCAGCACACAGCCACATGGG + Intronic
1065957307 10:30705021-30705043 GAAGCAGCACACAGCCACATGGG - Intergenic
1067184243 10:44013654-44013676 GAAGATGCAGAGATACAGAAAGG - Intergenic
1067185677 10:44025084-44025106 GGGTATGTACAGAGCCAGATGGG + Intergenic
1067687149 10:48472647-48472669 GAAGCAGCACAGAGGCAGATGGG - Intronic
1067774480 10:49153047-49153069 GAAGATGGGGAGAGCCAGCTTGG - Intergenic
1067930659 10:50558175-50558197 GAAGAAGCACAGAGGCAGGAGGG - Intronic
1069026179 10:63544648-63544670 GAAGGTACACAGAAGCAGATGGG + Intronic
1072249015 10:93567226-93567248 GAAGACGCAGAGAGGCAGAGCGG - Exonic
1072758036 10:98033567-98033589 GAGGATGCACAGAGAGAAATGGG - Intergenic
1072900437 10:99402311-99402333 GAAGTGGCTCAGAGCCAGCTGGG - Intronic
1075461700 10:122620744-122620766 GAAGCTGCACAGCTCCAGATAGG - Intronic
1075914935 10:126158699-126158721 GAGGATGCACAGAGCATGGTGGG + Intronic
1075914965 10:126158835-126158857 GTAGATGCACAGAGCACGGTGGG + Intronic
1075914975 10:126158880-126158902 GAGGATGCACAGAGCATGGTGGG + Intronic
1076243774 10:128930375-128930397 AAAAATGCACAGTGGCAGATTGG - Intergenic
1076491069 10:130862053-130862075 GAAGATGAGCGGAGCCAGCTTGG + Intergenic
1077333997 11:1995233-1995255 GGAGGGGCACAGAGCGAGATGGG + Intergenic
1079168073 11:18065696-18065718 GAACATGCACACAGCCTGAAGGG - Intergenic
1081291336 11:41329201-41329223 GCAGAGTCACAGAGCCAGTTAGG - Intronic
1081540969 11:44034199-44034221 GAAGACCCACAGTCCCAGATGGG - Intergenic
1083150501 11:60789011-60789033 CAAGAGCCAAAGAGCCAGATGGG - Intronic
1083475371 11:62911883-62911905 GAAGATAAACAGAGAGAGATGGG + Intronic
1083561689 11:63678083-63678105 GAAGATGCTCAAAGTTAGATAGG - Intergenic
1088728432 11:112659462-112659484 TGGGATGCAGAGAGCCAGATAGG + Intergenic
1202816980 11_KI270721v1_random:50415-50437 GGAGGGGCACAGAGCGAGATGGG + Intergenic
1091448013 12:555281-555303 GAAAATCCACAGAGCTAGAAAGG - Intronic
1091671230 12:2453622-2453644 GAGGATGCACAAAGCCCCATGGG - Intronic
1093466114 12:19451397-19451419 GAACATACACAGAGCTAGAGAGG - Intronic
1093641352 12:21529943-21529965 GAAAATGTGCAGAGCCAGAAAGG + Intronic
1094731791 12:33185024-33185046 GAAGAACTACAGAGCCAGATGGG - Intergenic
1095110763 12:38293037-38293059 GAAGAAGCATAGAGACAGAAAGG + Intergenic
1095676626 12:44926712-44926734 CAAGAGACACAGAGGCAGATAGG - Intergenic
1096868136 12:54577293-54577315 GAAGATGAACACAACCAGAATGG + Exonic
1097172273 12:57122946-57122968 GAAGTTGCACAGGGTGAGATAGG + Intronic
1097728743 12:63104278-63104300 GCAGATGCACAGAGCCATGTGGG - Intergenic
1098504595 12:71234638-71234660 GAACATCCACAGAGCCAAAATGG - Intronic
1099652590 12:85447284-85447306 GACGATGCAGTGAGCCAGACTGG - Intergenic
1102233664 12:111280751-111280773 GAGGATGCACAGAGCCACACAGG - Intronic
1102851287 12:116247510-116247532 GAATTTGAGCAGAGCCAGATGGG - Intronic
1103190722 12:118999416-118999438 AAAGATGCACAGAATAAGATTGG - Intronic
1103870638 12:124088831-124088853 GAGGATGGACAGAGCCAAAGAGG - Intronic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1106382807 13:29256419-29256441 GATGAAGCTCAGAGCCAGAGGGG + Intronic
1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG + Intronic
1107218348 13:37949153-37949175 GAAAGTGCAGAGAGCCAGAGAGG - Intergenic
1108626717 13:52236212-52236234 GAAGATGGGTGGAGCCAGATGGG - Intergenic
1108659351 13:52570273-52570295 GAAGATGGGTGGAGCCAGATGGG + Intergenic
1110675465 13:78238008-78238030 GAAGATACAAAGAACCAAATGGG + Intergenic
1112728171 13:102329040-102329062 GAGGATGTACAGAACCATATGGG - Intronic
1113075309 13:106462205-106462227 GAAGTTGCAGAGAGACAGCTTGG + Intergenic
1113596996 13:111540344-111540366 GCAGGTGGACAGAGCCAGAGAGG - Intergenic
1114327739 14:21606363-21606385 CAGGATGCCCAGGGCCAGATAGG - Intergenic
1116187066 14:41610186-41610208 GGAGATGCCCAGAGCCACAGAGG + Intronic
1116788439 14:49313367-49313389 GAATATGCACAGCTCCAGATTGG - Intergenic
1117490160 14:56239192-56239214 GAAAATGCAGAGAGCAAGACAGG - Intronic
1121391081 14:93575309-93575331 AAAGATGAACACAGCGAGATGGG - Intronic
1122298000 14:100716284-100716306 GAAGCTGCCCAGAGACAGGTGGG - Intergenic
1125716537 15:41822821-41822843 GAACAAGCACAAAGCCAGATAGG - Intronic
1125816032 15:42585229-42585251 GAAGATGCCCAGAGCGGGAGAGG + Intronic
1126671365 15:51118371-51118393 AAGGTTGCAAAGAGCCAGATTGG - Intergenic
1126706564 15:51411368-51411390 GAACATGAACAGAGACAGACTGG + Intergenic
1126983030 15:54268299-54268321 GAAGATGCAAAGACCCAGTTAGG - Intronic
1127626417 15:60784503-60784525 AAAGATGCTCACAGCCAGGTAGG - Intronic
1131838421 15:96412734-96412756 GAAGATGGACAGGGGCTGATGGG - Intergenic
1132952067 16:2568605-2568627 AAAGCTGCACAGAGCCAGGGCGG + Intronic
1132962283 16:2631565-2631587 AAAGCTGCACAGAGCCAGGGCGG - Intergenic
1133019696 16:2961905-2961927 GCAGATGCACAGGTGCAGATTGG - Intergenic
1133569430 16:7026482-7026504 GAAGAAGAAAAGAGGCAGATTGG - Intronic
1133873408 16:9710755-9710777 GAAGATGGAGAGAGTCAGAGAGG + Intergenic
1134780378 16:16889895-16889917 GAAGAAACACAGAGACACATAGG - Intergenic
1135110333 16:19685977-19685999 GAAGACGACTAGAGCCAGATTGG + Intronic
1138065568 16:53937663-53937685 AAAGATGTTGAGAGCCAGATGGG - Intronic
1139483160 16:67241826-67241848 GAAGCAGCACAGACCCAGAAAGG + Intronic
1140151958 16:72376490-72376512 GGAGATGTACAGAACCACATAGG + Intergenic
1140704338 16:77612365-77612387 TAGGATGCTCAGAGCCAAATTGG + Intergenic
1141342880 16:83219359-83219381 GATTCTGCACACAGCCAGATTGG + Intronic
1142622914 17:1176235-1176257 CAAGAGGCACAGGGCCAGGTTGG + Intronic
1143104630 17:4522796-4522818 GAAGAGGCCCAGAGCAAGGTAGG - Intronic
1144133525 17:12270643-12270665 GAAGATGCAGAGAGCCTTTTTGG - Intergenic
1145819160 17:27818043-27818065 GGAGATGCACAGAGCAAGGTGGG - Intronic
1149469770 17:56906802-56906824 GAAGTTGCACAGTGAAAGATTGG - Intronic
1151268742 17:72977184-72977206 GAAGAAGCAGGGAGCCACATGGG + Intronic
1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG + Intronic
1152606746 17:81295240-81295262 GAAGAGCCGCAGAGCCAGCTAGG + Exonic
1157876132 18:51275273-51275295 GGAGATGCATAGAGCAGGATAGG - Intergenic
1158305183 18:56097442-56097464 GAAGATGCTCAGTGCATGATGGG - Intergenic
1158996647 18:62927304-62927326 AAAGATGAACAGATCCATATTGG + Intronic
1159527826 18:69616388-69616410 GAAGGAGCACAGGGCCAGCTAGG - Intronic
1160055121 18:75471858-75471880 GAAGATGCTTAGAGCCAAATGGG - Intergenic
1160388894 18:78515443-78515465 GCAGATGCTCTGAGCCAGAAGGG - Intergenic
1160557204 18:79733697-79733719 GAAGAGACACAGAGCAAGGTCGG - Intronic
1162259137 19:9518315-9518337 GAAGATGCCCAGAGCAAGAGAGG + Intergenic
1164013830 19:21234408-21234430 GAATAGGGACAGAGACAGATAGG + Intronic
1164020123 19:21294956-21294978 GACAATGCAAAGAGCCACATAGG + Intronic
1165023161 19:32940259-32940281 GAAGATGTATAGAGCGTGATGGG - Intronic
1165603570 19:37079400-37079422 GGAGGAGCACAGAGCCACATGGG - Intronic
1165952760 19:39483351-39483373 GCAGATGGTCAGAGACAGATGGG + Intronic
1166878225 19:45911239-45911261 GAAGATACAAAGAGGCAGAGTGG - Intergenic
1166883649 19:45944733-45944755 GCAGATCCACAGAGCCAAAAAGG + Intronic
925363744 2:3296833-3296855 AAAGATGCCCAGAGCTGGATGGG - Intronic
925507352 2:4583346-4583368 GAGGAAGCACAGAACCAGAAAGG + Intergenic
925907738 2:8549313-8549335 GAAGATGCACAAAGCCATGAAGG - Intergenic
926708589 2:15856685-15856707 CAAGAGGCACAGAGACAAATAGG + Intergenic
928104679 2:28461029-28461051 GAAGAAAAACAGAGCAAGATAGG + Intronic
931088856 2:58864439-58864461 AAAGTTGCCCAGAGGCAGATGGG + Intergenic
931428865 2:62194753-62194775 GCGGATGCACAGAGCCACGTGGG - Intergenic
931998761 2:67864133-67864155 GCAGATGCTTAGAGTCAGATTGG - Intergenic
933371934 2:81425368-81425390 GAAGATGCATAGAGAAGGATAGG - Intergenic
933832493 2:86222199-86222221 GAACATGCACAAAGCCATTTTGG - Intronic
936678524 2:114743773-114743795 GAAGTTTCATAGAGCCACATGGG + Intronic
937288574 2:120768287-120768309 GAGGAAGCACTGAGCCAGAGAGG + Intronic
939524005 2:143269543-143269565 GAAAATGCTCAGAGCCTAATTGG - Intronic
943324215 2:186478610-186478632 GAAGATATAAAGAGCCAAATTGG - Intergenic
943645461 2:190405006-190405028 GAAGATTGACAGAGCCCGAGAGG - Intergenic
944949299 2:204728861-204728883 GAAGATGCTCAGAGAGACATTGG + Intronic
945777133 2:214119132-214119154 AAAGATTCACAGAAACAGATAGG + Intronic
945867396 2:215191546-215191568 GAAGAAGCAGGGAGCCAGAAAGG + Intergenic
946181540 2:217952005-217952027 GAACATGAACACAGCCAGATGGG + Intronic
1170159076 20:13294521-13294543 CCAGATGCACAAAGCCACATTGG + Intronic
1170535164 20:17334020-17334042 GAAGAAGCAGAGACCCAGAAAGG + Intronic
1171033940 20:21701803-21701825 GAAGAAGAGCTGAGCCAGATCGG - Intergenic
1172788407 20:37485839-37485861 GAAGATGTAGAGAGGAAGATGGG + Intergenic
1175968364 20:62671292-62671314 GCAGCTGCAGAGAGCCAGAGCGG - Intronic
1178725559 21:35048390-35048412 GCACATGCACAGAGCCAGCCAGG - Intronic
1179434987 21:41355632-41355654 GAAAATCCACAGAGTCAGAAAGG + Intronic
1179989748 21:44941416-44941438 GAGGCTGCACACAGCCAGAAGGG - Intronic
1183349932 22:37329478-37329500 GAAGAGGGACAGAGCCAGGCAGG + Intergenic
1184182549 22:42840352-42840374 GAAGAAGCAGAGAGCCTGATGGG - Intronic
1184348564 22:43927959-43927981 GAAGATGCATAGAGGAAGCTCGG - Intronic
1184549996 22:45199424-45199446 GAGGCTGCACAGAGCCAGGAGGG + Intronic
952980001 3:38726900-38726922 GAAGCTGCAAAGAGCCTGTTTGG + Exonic
952992405 3:38843156-38843178 GAAGAGGCACTGAGCCAGGAAGG - Intergenic
953994947 3:47512702-47512724 GAAGCAGGACAGAGCCAAATTGG - Intronic
958485043 3:94694553-94694575 AAAGATGAACAAAGCAAGATTGG + Intergenic
959792402 3:110378642-110378664 GAAGAGGCACAGAGACAAACGGG + Intergenic
961563014 3:127743968-127743990 GATGATGCAGAGAGCCACAAAGG - Intronic
962677888 3:137769955-137769977 GAAGAGGCACAGGGACAGAAGGG + Intergenic
965854177 3:173067663-173067685 GAAGATGTAGAGAGGGAGATAGG + Intronic
965948796 3:174278428-174278450 GAAGATGGACACAGCCAAACTGG + Intronic
968173432 3:196528772-196528794 GAAGATGCTGGGAGCCGGATGGG - Intergenic
970535755 4:17028323-17028345 AAAGATGCACAGAGACACACAGG + Intergenic
972190361 4:36584067-36584089 TAAGATGCACAGAGACAGCGTGG + Intergenic
972794005 4:42398400-42398422 GAGGATGCACAGACCCAGGCAGG + Intronic
973824062 4:54687536-54687558 GAAGATGCAAAGGGGCAGAAAGG - Intronic
974877961 4:67720811-67720833 CAAGATCCACAGAGCTTGATGGG - Intergenic
976361955 4:84190181-84190203 GAAGATGCAAAGGCCAAGATGGG + Intergenic
977698761 4:99996942-99996964 GAAGCTGCAAACAACCAGATTGG + Intergenic
978253596 4:106664662-106664684 GAAGATGCACAATGACAAATAGG - Intergenic
979807627 4:124994350-124994372 GTAGATACACACAGCAAGATGGG + Intergenic
980103159 4:128562096-128562118 AAACATGCACAGAACAAGATGGG - Intergenic
981734283 4:147933460-147933482 GAACAGGCACAAAGCCAGACTGG - Intronic
982443234 4:155460795-155460817 GAAGATGGTCAGAGCCACAGAGG + Intergenic
985304371 4:188522351-188522373 GAAGAGCCACAGAGCCAGGAGGG + Intergenic
985597674 5:803975-803997 GAAGATGAACAGAGCTTGAAAGG + Intronic
986292975 5:6415200-6415222 GAAGATGCAGAGATGCAGAGGGG - Intergenic
987431041 5:17833376-17833398 CAAGAAGCACACAGCCAGATAGG - Intergenic
991114565 5:62939107-62939129 GAAGATGAAGGGAGCCACATGGG - Intergenic
991630160 5:68648665-68648687 GAAGAAGCCCACAGCCACATGGG + Intergenic
991961349 5:72047615-72047637 GAAGATCCAAAGAAGCAGATAGG - Intergenic
992299054 5:75358971-75358993 GATGATACACACAGACAGATGGG - Intronic
994450410 5:99934310-99934332 GAAGATAAACTCAGCCAGATAGG - Intergenic
996946406 5:129074817-129074839 GAAGATGGAAAGAGTCAGAAAGG - Intergenic
998186476 5:139983418-139983440 GAAGAGGAGCAGATCCAGATGGG - Intronic
1000402905 5:160851073-160851095 GAAGTAGCAGAGTGCCAGATTGG + Intronic
1001923244 5:175617190-175617212 CTGGATGCACAGAGCCAGAAAGG + Intergenic
1007330966 6:41108204-41108226 CATGATGCACAGAGCCATGTGGG + Intergenic
1007734771 6:43973645-43973667 GAAGATGCTCAAAGCTAGCTGGG - Intergenic
1007961836 6:45967216-45967238 GTGGATCCACACAGCCAGATGGG + Intronic
1008658354 6:53639640-53639662 GGATATGCACAGAGCCTCATGGG - Intergenic
1010646518 6:78395349-78395371 GAAAATGCAGGAAGCCAGATTGG + Intergenic
1012072581 6:94641477-94641499 GACAAGGCACAGAGTCAGATAGG + Intergenic
1012078538 6:94726783-94726805 GAAGAAGTACAGAGCAAAATGGG + Intergenic
1016005175 6:139082161-139082183 GAGGGTGCAGAGAGCCAGAAAGG + Intergenic
1016054397 6:139564481-139564503 GAGGAGGCAGAGAGACAGATTGG - Intergenic
1016976166 6:149810787-149810809 AAAGAGGCACAGAGCCAAATTGG + Exonic
1017621713 6:156306311-156306333 GAAGCAGCATAGAACCAGATTGG + Intergenic
1017736194 6:157366834-157366856 GCAGATGCGCAGAGCTAGGTAGG + Intergenic
1022550494 7:31234761-31234783 GAAGATGCCTAGAGCCGGCTTGG - Intergenic
1022770592 7:33468132-33468154 GAAGATGAAAAGAGAGAGATCGG + Intronic
1025242468 7:57289107-57289129 GTAGATACATAGATCCAGATAGG - Intergenic
1028512573 7:91641394-91641416 GAAGATGCACATAACCAATTAGG - Intergenic
1029374673 7:100170494-100170516 GAAGAGGGACAGAGCAGGATGGG + Intronic
1030512933 7:110506897-110506919 TTAGATGCACTGAGTCAGATAGG + Intergenic
1031633625 7:124074867-124074889 GAAGGTGGACAGAGTCAGACAGG + Intergenic
1032704972 7:134413784-134413806 AAGGATGCACAGAGCCTGGTAGG - Intergenic
1033827234 7:145206509-145206531 GAAGAAGCACTGAGTCATATAGG + Intergenic
1035053396 7:156017666-156017688 CAGGATGCACAGAGCCAGGTGGG + Intergenic
1037522497 8:19693439-19693461 GAAGATGCGAAAAGCCAAATAGG - Intronic
1038627564 8:29208918-29208940 GCAGATGCACAGAGGCAGGCAGG - Intronic
1040080215 8:43276758-43276780 GAAAATGCAAACAGCCAGACCGG - Intergenic
1040693317 8:49965990-49966012 GAAGATGCACAGAGCTTAGTTGG - Intronic
1044314639 8:90735539-90735561 AAAGAAGCTCAGAACCAGATGGG + Intronic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1045476594 8:102557858-102557880 GGGGAAGCACAGAGCAAGATGGG - Intronic
1045780709 8:105859836-105859858 GAAGGTGGACAGAGCCATTTTGG + Intergenic
1046450393 8:114383090-114383112 GAAGATGCCCAGAGGCTTATGGG + Intergenic
1047746976 8:127852514-127852536 GAGGATGCTGAGAGCCAGAAAGG - Intergenic
1048021397 8:130542457-130542479 GAAGATGGCCAGAACCAGGTTGG - Intergenic
1048368111 8:133756266-133756288 GAAGATGCTCAGATCCACAGAGG - Intergenic
1049549123 8:143248483-143248505 GAGTCTGCAGAGAGCCAGATAGG + Intronic
1050346150 9:4690074-4690096 GAAGATACATAGTGCCAGATGGG - Intronic
1050949062 9:11565359-11565381 GAAGAGGCAGAGAGAAAGATAGG - Intergenic
1051405549 9:16734253-16734275 GAAGACGTACAGAAGCAGATAGG - Intronic
1052138963 9:24954137-24954159 CAAGATGCACAGAGACTCATGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053412804 9:37926585-37926607 GAATCTTCACAGAGCCAGAGTGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056249974 9:84737789-84737811 GAAGATGGAGAGAGACGGATGGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057376544 9:94529100-94529122 GAAAGTGAACAGAACCAGATGGG - Intergenic
1057593267 9:96392347-96392369 GAAGATGCACAGCGCGGGCTGGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058106266 9:100975592-100975614 GGAGAAGCAGAGAGCCAGAATGG - Intergenic
1058814913 9:108674214-108674236 GCAAATGCACAGAGCAAGAAGGG + Intergenic
1059519743 9:114930151-114930173 GACAAGGCACAGAGCCAGAGTGG + Exonic
1060559509 9:124531224-124531246 GAAGATGCCTTGAGCTAGATGGG - Intronic
1060611891 9:124974074-124974096 GCAGATAGACAGAGCCTGATGGG - Intronic
1062092062 9:134683551-134683573 GAGGATGCAGAGAGACAGACTGG - Intronic
1062093231 9:134689523-134689545 GAGGATGCAGAGAGACAGACTGG - Intronic
1185671358 X:1812641-1812663 GAGGTTGCAGTGAGCCAGATTGG + Intergenic
1186238856 X:7545033-7545055 GAAGCAGCACAAAACCAGATAGG - Intergenic
1187299548 X:18034373-18034395 GAAGATGCCCAGAGTCACACGGG - Intergenic
1189445200 X:41074882-41074904 GGAGATGCAGAGAGGCAGGTTGG + Intergenic
1190216195 X:48481098-48481120 GAAGATGCACAGAGCCAGATGGG + Intronic
1190737165 X:53263282-53263304 GAAGATGCACAGAGCTGGGATGG + Intronic
1192565323 X:72158590-72158612 GAAGTTGCACACTGCCAGGTGGG + Intergenic
1193092748 X:77511870-77511892 GAGGAGGCAGAGAGACAGATAGG + Intronic
1195678063 X:107522567-107522589 GAAGAGGCACAGACCCACAGTGG - Intronic
1195834717 X:109101529-109101551 GAAGAGGCACAGAAAGAGATAGG - Intergenic
1196921623 X:120591191-120591213 GAAGAAGCACAGAGCAATATGGG + Intergenic
1198091547 X:133335985-133336007 GAAGTTGCACAGAGACAGCTGGG - Intronic
1199006296 X:142701081-142701103 GAAGAAACACAGATCCAGAGAGG - Intergenic
1200684585 Y:6247070-6247092 GAAGACGCCCAGTCCCAGATCGG - Intronic
1200830976 Y:7688734-7688756 GAAGACGCCCAGTCCCAGATTGG + Intergenic
1200990114 Y:9338329-9338351 GAAGACGCCCAGTCCCAGATCGG - Intronic
1200992776 Y:9358644-9358666 GAAGACGCCCAGTCCCAGATCGG - Intronic
1200995429 Y:9378922-9378944 GAAGACGCCCAGTCCCAGATCGG - Intronic
1200998094 Y:9399268-9399290 GAAGACGCCCAGTCCCAGATCGG - Intronic
1201000604 Y:9467802-9467824 GAAGACGCCCAGTCCCAGATCGG - Intronic
1201003270 Y:9488132-9488154 GAAGACGCCCAGTCCCAGATCGG - Intronic
1201005927 Y:9508414-9508436 GAAGACGCCCAGTCCCAGATCGG - Intergenic
1201008584 Y:9528727-9528749 GAAGACGCCCAGTCCCAGATCGG - Intronic