ID: 1190217778

View in Genome Browser
Species Human (GRCh38)
Location X:48491579-48491601
Sequence ATGTCTGTGCACATGTACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190217770_1190217778 21 Left 1190217770 X:48491535-48491557 CCGTGCAAGTGTGAGTGAACAGG No data
Right 1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG No data
1190217769_1190217778 22 Left 1190217769 X:48491534-48491556 CCCGTGCAAGTGTGAGTGAACAG No data
Right 1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG No data
1190217766_1190217778 27 Left 1190217766 X:48491529-48491551 CCCGCCCCGTGCAAGTGTGAGTG No data
Right 1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG No data
1190217764_1190217778 29 Left 1190217764 X:48491527-48491549 CCCCCGCCCCGTGCAAGTGTGAG No data
Right 1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG No data
1190217768_1190217778 23 Left 1190217768 X:48491533-48491555 CCCCGTGCAAGTGTGAGTGAACA No data
Right 1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG No data
1190217765_1190217778 28 Left 1190217765 X:48491528-48491550 CCCCGCCCCGTGCAAGTGTGAGT No data
Right 1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG No data
1190217767_1190217778 26 Left 1190217767 X:48491530-48491552 CCGCCCCGTGCAAGTGTGAGTGA No data
Right 1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG No data
1190217763_1190217778 30 Left 1190217763 X:48491526-48491548 CCCCCCGCCCCGTGCAAGTGTGA No data
Right 1190217778 X:48491579-48491601 ATGTCTGTGCACATGTACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190217778 Original CRISPR ATGTCTGTGCACATGTACGT GGG Intergenic
No off target data available for this crispr