ID: 1190218391

View in Genome Browser
Species Human (GRCh38)
Location X:48495220-48495242
Sequence AAGTCCCTTCTCCCCCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190218391_1190218393 2 Left 1190218391 X:48495220-48495242 CCAAGCTGGGGGAGAAGGGACTT No data
Right 1190218393 X:48495245-48495267 TTGAAGTGACCCTCATGGACTGG No data
1190218391_1190218395 8 Left 1190218391 X:48495220-48495242 CCAAGCTGGGGGAGAAGGGACTT No data
Right 1190218395 X:48495251-48495273 TGACCCTCATGGACTGGGACTGG No data
1190218391_1190218394 3 Left 1190218391 X:48495220-48495242 CCAAGCTGGGGGAGAAGGGACTT No data
Right 1190218394 X:48495246-48495268 TGAAGTGACCCTCATGGACTGGG No data
1190218391_1190218398 12 Left 1190218391 X:48495220-48495242 CCAAGCTGGGGGAGAAGGGACTT No data
Right 1190218398 X:48495255-48495277 CCTCATGGACTGGGACTGGAAGG No data
1190218391_1190218392 -3 Left 1190218391 X:48495220-48495242 CCAAGCTGGGGGAGAAGGGACTT No data
Right 1190218392 X:48495240-48495262 CTTGCTTGAAGTGACCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190218391 Original CRISPR AAGTCCCTTCTCCCCCAGCT TGG (reversed) Intergenic
No off target data available for this crispr