ID: 1190218398

View in Genome Browser
Species Human (GRCh38)
Location X:48495255-48495277
Sequence CCTCATGGACTGGGACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190218391_1190218398 12 Left 1190218391 X:48495220-48495242 CCAAGCTGGGGGAGAAGGGACTT No data
Right 1190218398 X:48495255-48495277 CCTCATGGACTGGGACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190218398 Original CRISPR CCTCATGGACTGGGACTGGA AGG Intergenic
No off target data available for this crispr