ID: 1190221193

View in Genome Browser
Species Human (GRCh38)
Location X:48513398-48513420
Sequence TAGACAACACCAAGCCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 719
Summary {0: 1, 1: 0, 2: 18, 3: 170, 4: 530}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190221193_1190221201 20 Left 1190221193 X:48513398-48513420 CCCTGATGGCTTGGTGTTGTCTA 0: 1
1: 0
2: 18
3: 170
4: 530
Right 1190221201 X:48513441-48513463 TCTGGTCTGTGCCTGTCTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 301
1190221193_1190221198 2 Left 1190221193 X:48513398-48513420 CCCTGATGGCTTGGTGTTGTCTA 0: 1
1: 0
2: 18
3: 170
4: 530
Right 1190221198 X:48513423-48513445 TGAGGGGTTGTACCCGACTCTGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190221193 Original CRISPR TAGACAACACCAAGCCATCA GGG (reversed) Intronic
905319886 1:37108346-37108368 CAGACATCACCAATCAATCATGG + Intergenic
906617941 1:47247712-47247734 AAGATAACACCAAACCATGAGGG + Intergenic
906847812 1:49213419-49213441 AAGACAGCACCAAGCCATGAGGG - Intronic
907781700 1:57572935-57572957 AAGACAGCACCAAACCATTAAGG + Intronic
908206778 1:61858620-61858642 AAGACAGCACCAAGCCATGAGGG + Intronic
909060288 1:70871326-70871348 AGGACACCACCAAGCCATGATGG + Intronic
909096347 1:71293050-71293072 AAAACAGCACCAAGCCATGAGGG - Intergenic
909116250 1:71541006-71541028 AAGACAGCACCAAGCCATGAGGG + Intronic
909129637 1:71718237-71718259 AAGACAACACCAACTCATGAGGG - Intronic
909167553 1:72248072-72248094 AAGACAGCACCAAGCCATGAGGG + Intronic
909573113 1:77140150-77140172 AAGACAGCACCAAGCCATGAGGG - Intronic
909756271 1:79230015-79230037 AGGACAGCACCAAGCCATGAAGG + Intergenic
910309834 1:85810617-85810639 AAGACAGCACCAAGCCATGAGGG - Intronic
910611144 1:89143771-89143793 CAGACAGCAGCAAGCCATAAAGG + Intronic
910738104 1:90484572-90484594 AGGACAGCACCAAGCCATGAGGG - Intergenic
911126816 1:94348146-94348168 AAGACAGCACCAAGCCATGAGGG - Intergenic
911369028 1:96974219-96974241 AAGACACCACCAAGCCATGAGGG - Intergenic
911457879 1:98150302-98150324 AGGACAACACCAAGTCATGAGGG + Intergenic
911659760 1:100488129-100488151 AAGATAACTCCAAGCCATAATGG - Intronic
911698807 1:100926490-100926512 AAGACAGCACCAAGCCATGAGGG + Intronic
911761780 1:101625566-101625588 GAGACAGCACCAAGCCATGAGGG - Intergenic
911819784 1:102403076-102403098 AAGACAGTACCAAGCCATGAGGG + Intergenic
912532149 1:110333075-110333097 AGGACAGCACCAAGCCATGAAGG + Intergenic
912854638 1:113156376-113156398 AAGACAGCACCAAGCCAAGAGGG + Intergenic
912861033 1:113214163-113214185 AAGACAGCATCAAGCCATGAGGG + Intergenic
913032414 1:114922567-114922589 CAGGCATCACCAAGCCATGAGGG + Intronic
913100580 1:115560488-115560510 AAGACAGCATCAAGCCATGAGGG + Intergenic
913111097 1:115657975-115657997 AAGATAGCACCAAGCCATGAGGG + Intronic
913302665 1:117388626-117388648 AGGACAGCACCAAGCCATGAGGG + Intronic
913969758 1:143405702-143405724 AAGACAGCAGCAAGCCATGAGGG - Intergenic
914064131 1:144231295-144231317 AAGACAGCAGCAAGCCATGAGGG - Intergenic
914115019 1:144735059-144735081 AAGACAGCAGCAAGCCATGAGGG + Intergenic
915019438 1:152765202-152765224 TGGAGAACACCAAGCCATTGGGG - Intronic
915062696 1:153199382-153199404 TGGCCAACACCCAGCCAGCAGGG + Intergenic
916834112 1:168524618-168524640 AAGACAGCACCAAGCCATGAGGG + Intergenic
916982403 1:170152956-170152978 AGGACAACACCAAGGCATGAGGG - Intronic
916982670 1:170154934-170154956 AGGACAGCACCAAGCCATGAGGG - Intronic
917045810 1:170858894-170858916 AGGACAGCACCAAGCCATGAGGG - Intergenic
917447520 1:175119186-175119208 TGGACAACCACAAGCCCTCAGGG - Intronic
917532532 1:175849805-175849827 AAGACAGCACCAAGCCATAAAGG + Intergenic
917554660 1:176071144-176071166 AAGATAGCACCAAGCCATGAGGG - Intronic
917811148 1:178659545-178659567 AAGACAGCACCAATCCATAAGGG + Intergenic
918692337 1:187497105-187497127 AAGAAAGCACCAAGCCATGAGGG + Intergenic
918963688 1:191312166-191312188 AAGAAAACACCAAGCCATGAGGG - Intergenic
919056132 1:192571258-192571280 AAGACAGCACCAAGCTATGAGGG + Intergenic
919233612 1:194807933-194807955 AGGACAACACCAAGCCATGAGGG - Intergenic
919577585 1:199331021-199331043 AGGACAGCACCAAGCCATGAGGG + Intergenic
919652470 1:200163998-200164020 AAGACAACACCAGGCCCTGAGGG - Intronic
920777873 1:208958034-208958056 AAGATAGCACCAAGCCATGAGGG - Intergenic
921128177 1:212196355-212196377 AAGACAGCACCAAGCCATGAGGG - Intergenic
921134151 1:212245163-212245185 AGGACAACACCAAGCCATGAGGG - Intergenic
921211004 1:212897778-212897800 AGGACAGCACCAAGCCATGAGGG + Exonic
921376827 1:214483288-214483310 TACACAACAGCAAATCATCAGGG - Intronic
921399018 1:214699986-214700008 AAGATAGCAGCAAGCCATCAGGG - Intergenic
921443945 1:215222109-215222131 TAAACAGCACCAAGCCATGAGGG + Intronic
921618936 1:217305310-217305332 AGGACAGCACCAAGCCATGAGGG - Intergenic
922335187 1:224613613-224613635 AGGACAGCACCAAGCCATGAGGG - Intronic
923139685 1:231150917-231150939 AAGACAGCACCAAGCCATGAGGG + Intergenic
923231722 1:231992973-231992995 TAGACAAAACCCAGAGATCAAGG + Intronic
924324772 1:242884703-242884725 AGGACAACACCAAGCCATAAGGG - Intergenic
1063452664 10:6161695-6161717 TAGACAACAGCAAGTCCTGATGG - Intronic
1063696592 10:8341508-8341530 AAGACATCACCAAGCCATGAGGG + Intergenic
1063764416 10:9121581-9121603 AAGACAGCACCTAGCCATGAGGG - Intergenic
1064125373 10:12655300-12655322 AAGACAGCACCAAGCCATGAGGG + Intronic
1064654106 10:17539548-17539570 AAGACAGCACCAAGCCATGAAGG - Intergenic
1065180651 10:23121389-23121411 AGGACAGCACCAAGCCATGAGGG + Exonic
1066338103 10:34501240-34501262 AAGACAGCACCAAACCATGAAGG - Intronic
1067798052 10:49335006-49335028 AAGACAACACCAAGCCATGAGGG + Intergenic
1067896541 10:50186996-50187018 TAAACAACCCCAAGACTTCAAGG + Exonic
1067952431 10:50755031-50755053 TAAACAACCCCAAGACTTCAAGG - Intronic
1068008686 10:51420957-51420979 TAGACAGCATCAAGCCTTGAGGG + Intronic
1068212040 10:53932886-53932908 AAGACAACACCAAGCCATGAGGG - Intronic
1068291486 10:55006945-55006967 AAGACAGCACTAAGCCATGAAGG - Intronic
1068507991 10:57927430-57927452 AAGACAACACCAAGCCATGAGGG + Intergenic
1069946341 10:71988426-71988448 AAGACAGCACCAAGCCATGAGGG - Intronic
1070581479 10:77723557-77723579 AAGACAACACCAAGCCACGAGGG - Intergenic
1070581754 10:77725572-77725594 AAGACAGCACCAAGCCATGAGGG - Intergenic
1071396155 10:85226042-85226064 AAGACAGCACCAAGCTATGAGGG + Intergenic
1071667061 10:87568692-87568714 AAGACAGCACCAAGCCCTGAGGG - Intergenic
1072505526 10:96062629-96062651 AGGACAGCACCAAGCCATGAGGG + Intergenic
1073554595 10:104436624-104436646 AGGACAGCACCAAGCCATGAGGG + Intronic
1073886615 10:108047124-108047146 AAGACAGCACCCAGCCATGAGGG + Intergenic
1074100258 10:110349100-110349122 AAGACAACACTAAGCCATGAGGG + Intergenic
1074702756 10:116106837-116106859 AGGACAGCACCAAGCCATGAGGG - Intronic
1074710849 10:116176417-116176439 AGGACAGCACCGAGCCATCAGGG - Intronic
1074820539 10:117175090-117175112 TAGGCAACACCGAGGCATCCTGG + Intergenic
1074945553 10:118277695-118277717 AAGACAGCACCAAGCTATGAGGG + Intergenic
1075650941 10:124128142-124128164 TAGACAAGCCCCGGCCATCAGGG + Intergenic
1075915529 10:126162935-126162957 AAGACAGCACCAAGCCATCAAGG - Intronic
1076473846 10:130738766-130738788 AAGACAGCACCAAGCCACAAGGG - Intergenic
1077868684 11:6243465-6243487 AAGACAGCATCAAGCCATGAAGG + Intronic
1077933892 11:6762497-6762519 AGGACAGCACCAAGCCATGAGGG - Intergenic
1078994640 11:16685032-16685054 AGGACAGCACCAAGCCATGAGGG + Intronic
1079299822 11:19268036-19268058 AAGACATCACCAAGCCATAAGGG + Intergenic
1079664932 11:23093163-23093185 TAGACAATACCCAGCTTTCAAGG + Intergenic
1080155603 11:29106972-29106994 AAGACAGCACCAAACCATGAGGG - Intergenic
1080333854 11:31174229-31174251 TAGGCAACTCCAAGCCTGCAGGG - Intronic
1080572822 11:33571673-33571695 AGGACAGCACCAAGCCATGAGGG + Intronic
1080584047 11:33665842-33665864 CAGACACCCCCAAGCCAGCAGGG + Intronic
1080858955 11:36136458-36136480 GAGACAGCACCAAGCCATGAAGG - Intronic
1081180713 11:39983395-39983417 AAGACAGCACCAAGCCATGAGGG - Intergenic
1081265283 11:41013953-41013975 AGGACAGCACCAAGCCATGAGGG + Intronic
1081552057 11:44122676-44122698 TATACAACAGCAACCCAGCAGGG - Intronic
1082036872 11:47652083-47652105 AAGACAGCACCAAGCCATGAGGG - Intergenic
1083255420 11:61492463-61492485 AGGACAGCACCAAGCCATGAGGG - Intergenic
1084498842 11:69522653-69522675 AAGACAGCACCAAGCCATGAGGG + Intergenic
1084925583 11:72508775-72508797 AAGACACCACCAAGCCGTGAGGG + Intergenic
1085851499 11:80125273-80125295 AGGACAGCACCAAGCCATGAAGG - Intergenic
1086339959 11:85838670-85838692 AAGACAGCACCAAGCCATGAGGG + Intergenic
1086470748 11:87107024-87107046 AAGACAGCACCAAGCCATGAGGG + Intronic
1086774420 11:90812437-90812459 AAGACAGCACCAAGCCATGAGGG + Intergenic
1087095660 11:94314986-94315008 AAGACAGCACCAAGTCATGAGGG - Intergenic
1087192348 11:95268186-95268208 AAGACAGTACCAAGCCATGAGGG - Intergenic
1087301236 11:96438983-96439005 AGGACAGCACCAAGCCATGAGGG + Intronic
1087303060 11:96457788-96457810 AGGACAGCACCAAGCCATGAGGG - Intronic
1087614387 11:100471409-100471431 TAAACTTCACCAAGCCAGCAAGG - Intergenic
1087995591 11:104803871-104803893 CAGAAAACAACAAGCCAGCATGG + Intergenic
1088073754 11:105821608-105821630 AAGACAGCACCCAGCCATGAGGG + Intronic
1088406904 11:109491575-109491597 AAGACAGCACCAAGCCGTGAGGG - Intergenic
1088460418 11:110076531-110076553 AGGACAGCACCAAGTCATCAGGG + Intergenic
1089005672 11:115088764-115088786 AGGACAGCACCAAGCCATGAAGG - Intergenic
1091713194 12:2756972-2756994 AAGACAGCACCAAGCCACAAGGG + Intergenic
1092082379 12:5727170-5727192 AAGACAGCACCAAGCCATGAGGG - Intronic
1093061991 12:14617002-14617024 AAGACAGCACCAAGCCATGAGGG - Intronic
1093187825 12:16042092-16042114 AAGACAGCACCAAGCCATGAGGG + Intergenic
1094144068 12:27210623-27210645 AGGACAACACTAAGCCATGAGGG - Intergenic
1094432848 12:30388898-30388920 AAGACAGCAGCAAGCCATGAGGG + Intergenic
1094708775 12:32940630-32940652 AAGACAGCACCAAGCCATGAGGG - Intergenic
1096136780 12:49209309-49209331 AAGACAGCACCAAGCCACCCGGG + Intronic
1097152062 12:56986478-56986500 AGGACAGCACCAAGCCATGAGGG - Intergenic
1097429511 12:59487113-59487135 TAGATAACATTAAGCCCTCAAGG - Intergenic
1098768784 12:74525174-74525196 AGGACAGCACCAAGCCATGAGGG + Intergenic
1099095108 12:78365632-78365654 AAGACAGCACCAAGCCATGAAGG - Intergenic
1099360615 12:81695339-81695361 AAGACACCATCAAGCCATGAAGG - Intronic
1099475479 12:83103557-83103579 GGGACAGCACCAAGCCATGAGGG + Intronic
1099475748 12:83105613-83105635 AAGACAACACCAAGCCATGAGGG + Intronic
1099626049 12:85075586-85075608 AAGACAGCACCAAGCCCTGATGG + Intronic
1099626826 12:85086338-85086360 AAGACAACACCATGCCATGAGGG - Intronic
1099627316 12:85090989-85091011 AAGACAGCATCAAGCTATCAGGG - Intronic
1100208420 12:92376242-92376264 AGGACAGCACCAAGCCATGAGGG - Intergenic
1100383401 12:94083351-94083373 AGGACAGCACCAAGCCATGAGGG - Intergenic
1102541971 12:113627432-113627454 AAGACAGCACCAAACCATGAGGG + Intergenic
1103645606 12:122389912-122389934 AAGACAGCACCTAGCCATGAGGG - Intronic
1104142832 12:126004909-126004931 AAGACAGCACCAAGCCATGAAGG - Intergenic
1104331970 12:127855523-127855545 AAGACAGCACCAAGCCATGAAGG + Intergenic
1104572722 12:129939109-129939131 AAGAGAGCACCAAGCCATGAGGG + Intergenic
1105046620 12:133009030-133009052 AAGACTGCACCAAGCCATGAGGG + Intronic
1106092347 13:26607971-26607993 TAGACCACACCAAACCAGAATGG - Intronic
1107438892 13:40406433-40406455 CAGACATCACCAATCAATCATGG - Intergenic
1107635363 13:42386906-42386928 AGGACAGCACCAAGCCATGAGGG + Intergenic
1108896275 13:55333243-55333265 AAGACAGCACTAAGCCATGAGGG - Intergenic
1108896566 13:55335557-55335579 AAGACAGCACCAAGCCATGAAGG - Intergenic
1109251993 13:60031290-60031312 AAGACAGCACCAAGCCATGAGGG + Intronic
1109277514 13:60319250-60319272 TGGACAGCACCAAGCCAGGAGGG + Intergenic
1109304692 13:60625680-60625702 TATAAAACTCCATGCCATCATGG + Intergenic
1109333378 13:60960235-60960257 TGGAAAACATCAAGACATCAAGG + Intergenic
1109345825 13:61113624-61113646 TAGAGAAGACCAAGGCAGCAGGG - Intergenic
1109584848 13:64386418-64386440 AGGACAGCACCAAGCCATGAGGG + Intergenic
1109721583 13:66282822-66282844 AAGATAGCACCAAGCCATTAGGG + Intergenic
1109771624 13:66982039-66982061 AAGACAGCATCAAGCCATGAGGG - Intronic
1109843429 13:67951357-67951379 AAGACAGCACCAAACCATGAGGG + Intergenic
1109903226 13:68802175-68802197 AAGACAGCACCAAGCCATGAAGG - Intergenic
1110914310 13:81002399-81002421 AAGACAGCATCAAGCCATGAGGG + Intergenic
1110994441 13:82087938-82087960 AGGACAGCACCAAGCCATGAGGG + Intergenic
1111122968 13:83878983-83879005 TAGCCAACAGGGAGCCATCACGG + Exonic
1111234775 13:85394726-85394748 AGGACAGCACCAAGCCATGAGGG + Intergenic
1111631011 13:90846234-90846256 AAGACAGCACCAAGCCATGAGGG - Intergenic
1111817273 13:93169448-93169470 AAGATAGCACCAAGCCATGAGGG - Intergenic
1112067735 13:95812674-95812696 AAGACAGCACCAAGCCATGAAGG - Intronic
1112080847 13:95968505-95968527 AAGACAACACCAAGACATGAGGG - Intronic
1112223960 13:97519151-97519173 AGGACAGCACCAAGCCATGAGGG + Intergenic
1112909332 13:104462563-104462585 AAGACAGCACCGAGCCATGAGGG + Intergenic
1112999063 13:105610979-105611001 AGGACAGCACCAAGCCATGAGGG + Intergenic
1113026085 13:105942874-105942896 AAGACAGCACCAAACCATGAGGG - Intergenic
1113499415 13:110761328-110761350 CAGACAGCACCAAGCCATGAGGG - Intergenic
1113507555 13:110827516-110827538 AAGACAATACCAAGCCATGAGGG - Intergenic
1114337672 14:21708926-21708948 AAGACAGCACTAAGCCATGAGGG - Intergenic
1114383297 14:22231611-22231633 AAGACAGCACCAAGCCATAAGGG + Intergenic
1114383572 14:22233630-22233652 AAGACAGCACCAAGTCATGAGGG + Intergenic
1115146803 14:30236192-30236214 AAGACAGCACCAAGCCATGAGGG + Intergenic
1115196555 14:30806774-30806796 AAGATAGCACCAAGCCATGAGGG + Intergenic
1115224360 14:31087734-31087756 TCGACAACACCAAGGCACCATGG - Intronic
1115855656 14:37627019-37627041 AAGAGAGCACCAAGCCATGAGGG - Intronic
1115977402 14:39012162-39012184 AAGATAGCACCAAGCCATGAGGG - Intergenic
1116383034 14:44296285-44296307 AAAACAGCACCAACCCATCAGGG + Intergenic
1116902039 14:50370831-50370853 AAGACAACACCAAGTAATGAGGG + Intronic
1117209773 14:53483393-53483415 AGGACAGCACCAAGCCATGAAGG + Intergenic
1117456793 14:55905894-55905916 AAGATAACACCAAGCCATGAGGG + Intergenic
1117477518 14:56111521-56111543 AAGACAGCACCAAGCCATGAGGG - Intergenic
1117542050 14:56757778-56757800 AAGAGAACACCCAGGCATCAAGG + Intergenic
1118268396 14:64317547-64317569 AGGACAGCACCAAGCCATGAGGG + Intronic
1118896090 14:69946830-69946852 AGGACAGCACCAAGCCATGAGGG - Intronic
1119203636 14:72777649-72777671 AAGACAGCACCAAGCCATGAGGG - Intronic
1119862124 14:77943874-77943896 AAGACATCACCAAGCCATGAAGG + Intergenic
1120382170 14:83794236-83794258 AAGACAGCACCAAGCCATGAGGG - Intergenic
1120497918 14:85259591-85259613 AAGACATCACCAAGCCGTGAGGG - Intergenic
1120514682 14:85456826-85456848 AGGACAGCACCAAGCCATGAGGG - Intergenic
1120935161 14:89888565-89888587 AAGACAGCACCAAGCCTTGAGGG + Intronic
1121481236 14:94276621-94276643 AAGAAAACACCAAGCCGTGAGGG + Intronic
1123451370 15:20363691-20363713 AGGACAGCACCAAGACATCAGGG - Intergenic
1124025506 15:25961799-25961821 AAGACAGCACCAAACCATGAGGG - Intergenic
1124106738 15:26745145-26745167 AGGACAGCACCAAGCCATGAGGG + Intronic
1124711183 15:32013554-32013576 AAGACAGCATCAAGCCATGAGGG + Intergenic
1125881991 15:43203114-43203136 TAGACCACACCTTGCCATCAAGG - Exonic
1126052779 15:44701962-44701984 AGGACAGCACCAAGCCATGAGGG + Intronic
1126297003 15:47150890-47150912 AGGACAGCACCAAGCCATGAGGG + Intergenic
1126675120 15:51154339-51154361 AGGACAGCACCAAGCCATGAGGG + Intergenic
1126815188 15:52447208-52447230 AAGACAGCACCAAGCCATGAGGG - Intronic
1127263004 15:57339349-57339371 AGGACAGCACCAAGCCATGAGGG - Intergenic
1127507159 15:59608680-59608702 AGGACAGCGCCAAGCCATCAAGG + Intronic
1128336983 15:66793167-66793189 AAGACAGCACCAAGCCATGAGGG - Intergenic
1128534026 15:68476772-68476794 AGGACAGCACCAAGCCATGAAGG - Intergenic
1128643366 15:69356971-69356993 AAGACAGCACCAAGCCACGAGGG - Intronic
1129093771 15:73181683-73181705 AGGACAGCACCAAGCCATGAGGG + Intronic
1129173657 15:73823664-73823686 AGGACAGCACCAAGCCATGAGGG + Intergenic
1129271554 15:74421797-74421819 AAGGCAGCACCAAGCCATCAGGG + Intronic
1129477072 15:75792690-75792712 TGGAGAACACAAAGGCATCACGG + Intergenic
1129762675 15:78139844-78139866 AAGACAGCACCAAGCCATGGGGG + Intronic
1129970981 15:79777714-79777736 AAGACAGCACCTAGCCATGAGGG + Intergenic
1130075661 15:80687257-80687279 AGGACAGCACCAAGCCATGAGGG - Intronic
1130273452 15:82464345-82464367 TGGGCAGCACCAGGCCATCACGG + Intergenic
1130397578 15:83516680-83516702 AAGACAGCACCAAGTCATGAGGG + Intronic
1130465803 15:84191716-84191738 TGGGCAGCACCAGGCCATCACGG + Intergenic
1130486897 15:84403108-84403130 CAGGCAGCACCAGGCCATCATGG - Intergenic
1130498462 15:84481820-84481842 TGGGCAGCACCAGGCCATCACGG - Intergenic
1130588092 15:85196312-85196334 TGGGCAGCACCAGGCCATCACGG + Intergenic
1131727712 15:95244904-95244926 AAGACAACATCAAGCCATGAGGG + Intergenic
1131948741 15:97656984-97657006 AGGACAGCACCAAGCCATGAAGG + Intergenic
1132727288 16:1344440-1344462 CAGACACCACCAAGACAGCATGG - Intronic
1133863980 16:9624483-9624505 AAGATAGCACCAAGCCATGAGGG - Intergenic
1134214401 16:12305691-12305713 TACACAACACCCAGGCATCTAGG - Intronic
1134515681 16:14885117-14885139 AAGACAGCACCAAGCCACGAGGG + Intronic
1134703353 16:16283761-16283783 AAGACAGCACCAAGCCACGAGGG + Intronic
1134964190 16:18428353-18428375 AAGACAGCACCAAGCCACGAGGG - Intronic
1134968477 16:18510889-18510911 AAGACAGCACCAAGCCACGAGGG - Intronic
1135981068 16:27147715-27147737 AATACAGCACCAAGCCATGAGGG - Intergenic
1137529549 16:49269621-49269643 TTGACAACTCCAAGCCACCTAGG + Intergenic
1138015024 16:53420366-53420388 AGGACAGCACCAAGCCATGAGGG + Intergenic
1138074927 16:54032815-54032837 TGGACAGCACCAAGCCATGAGGG - Intronic
1138131206 16:54481608-54481630 TAATCAACACAAAGCCACCATGG - Intergenic
1138711168 16:58971881-58971903 AAGACAGTACCAAGCCATAAGGG + Intergenic
1140779420 16:78281233-78281255 AAGACAGCGCCAAGCCATGAGGG + Intronic
1140824219 16:78690845-78690867 GAGACAACATCAAGCCATCCTGG - Intronic
1140977561 16:80074768-80074790 TAGACAATGCCAAAACATCAGGG + Intergenic
1141069672 16:80942279-80942301 AAGACAGCACCAAGCCATGAGGG - Intergenic
1143991303 17:10964711-10964733 AGGACAGCACCAAGCCATTAGGG - Intergenic
1144323389 17:14153118-14153140 GACACAACACAGAGCCATCATGG + Intronic
1145020418 17:19426185-19426207 AAGACAGCACCATGCCATGAGGG + Intergenic
1145229780 17:21165188-21165210 GAGAAAACACCAAGCCAGCATGG - Intronic
1149369934 17:55983423-55983445 TGTACAACGGCAAGCCATCAAGG - Intergenic
1149584331 17:57775249-57775271 TAGACAAAACCAAGGCCTGATGG + Intergenic
1150329619 17:64284434-64284456 AGGACAGCACCAAGCCATGAGGG + Intergenic
1151089100 17:71414812-71414834 AAGACAGCAGCAAGCCATGAGGG + Intergenic
1151136163 17:71947391-71947413 AGGACAGCACCAAGCCATGAGGG - Intergenic
1151375701 17:73687300-73687322 AAGACAGCACCAAACCATGAGGG - Intergenic
1153170215 18:2307805-2307827 AAGACAGCACCAGGCCATGAGGG - Intergenic
1153954009 18:10080760-10080782 AGGACAGCACCAAGCCATGAGGG - Intergenic
1154083460 18:11280113-11280135 AAGACAGCACCAAGCCATGAGGG + Intergenic
1154284998 18:13046262-13046284 AAGATAACACCAAGCCATGAGGG + Intronic
1155552774 18:26983363-26983385 AGGACAGCACCAAGCCATGAGGG - Intronic
1155861118 18:30901115-30901137 AAGACTGCACCAAGCCATGAGGG + Intergenic
1156068398 18:33174234-33174256 AAGACAGCACCAAGCCATAAGGG + Intronic
1156115354 18:33780802-33780824 AAGACAGCACCAGGCCATGAGGG + Intergenic
1156696458 18:39773680-39773702 AAGACAGCAGCAAGCCATGAAGG - Intergenic
1156866201 18:41891424-41891446 AGGACAGCACCAAGCCATGAGGG - Intergenic
1157440274 18:47706233-47706255 AAAACAGCACCAAGCCATAAGGG + Intergenic
1157536543 18:48462824-48462846 TAGATAACACCAACTCATAATGG - Intergenic
1158194417 18:54868060-54868082 AAGACAGCACCAAGCCATGAGGG - Intronic
1159096295 18:63906200-63906222 AAGGCAGCACCAAGCCATAAGGG - Intronic
1159439538 18:68459560-68459582 AAGACAACAACAAGCAATAAAGG + Intergenic
1159695752 18:71554084-71554106 AGGACAACACCAAGCCATCAGGG - Intergenic
1160255775 18:77247577-77247599 AGGACAGCACCAAGCCATGAGGG + Intergenic
1160259853 18:77282333-77282355 AAGACAGCACCAAGCCATGAGGG - Intergenic
1160272940 18:77404005-77404027 AAGACGGCACCAAGCCATGAGGG + Intergenic
1161763706 19:6194036-6194058 AAGACAGCCCCAAGCCATGAGGG + Intronic
1163219077 19:15901411-15901433 AAGACCACATCAAGCCATGAGGG - Intergenic
1165041816 19:33073805-33073827 TAGACAAAACTAACCCATTATGG + Intergenic
1166866053 19:45838093-45838115 AAGACAGCACCAAGCCATGAGGG - Intronic
925498447 2:4478787-4478809 AGGACAGCACCAAGCCATGAGGG + Intergenic
925763806 2:7211685-7211707 AGGACAGCACCAAGCCATGAGGG - Intergenic
926328065 2:11802454-11802476 TATACAACTCCAAGCAATTAGGG - Intronic
926493827 2:13558995-13559017 AAGACAGTACCAAGCCATGAAGG + Intergenic
927039085 2:19210010-19210032 AAGACAGCCCCAAGCCATGAGGG - Intergenic
928318844 2:30267298-30267320 AGGACAGCACCAAGCCATTAGGG + Intronic
929255139 2:39802444-39802466 GGGACAGCACCAAGCCATTAGGG + Intergenic
929495683 2:42440517-42440539 TAGCAAATACCAAGCCAACAGGG + Intergenic
930118456 2:47740159-47740181 AAGACAGCACCAAGCCATGAGGG + Intronic
930418546 2:51120447-51120469 AGGACAGCACCAAGCCATGAGGG - Intergenic
931289799 2:60862401-60862423 CAGACAGCACCAAGCCTTGAGGG + Intergenic
932976476 2:76606294-76606316 AAGACAGCACCAAGCCATGAGGG - Intergenic
933158904 2:79002808-79002830 AAGACAGCACCAAGTCATGAGGG + Intergenic
933583579 2:84154952-84154974 AAGACCTCACCAAGCCATGAAGG - Intergenic
933850782 2:86364931-86364953 AAGACAGCACCAAGCCATGAGGG + Intergenic
934015958 2:87882057-87882079 AAGACAGCACCAAGCCATGAGGG + Intergenic
934174452 2:89566613-89566635 AAGACAGCAGCAAGCCATGAGGG - Intergenic
934284768 2:91640963-91640985 AAGACAGCAGCAAGCCATGAGGG - Intergenic
934892071 2:98079459-98079481 AAGACAGCACCAAGCCATGAGGG + Intergenic
935162333 2:100540099-100540121 TTGACACCTGCAAGCCATCAAGG - Intergenic
935300361 2:101688439-101688461 AAGACAGCACCAAGCCATGAGGG - Intergenic
935715829 2:105938116-105938138 AAGACAGCACCAAGCCATGAGGG - Intergenic
936890001 2:117358388-117358410 AGGACAGCACCAAGCCATGAGGG - Intergenic
937681126 2:124645966-124645988 AAGACAGCACCAAGCCATGAGGG + Intronic
938227523 2:129628536-129628558 AGGACAGCACCAAGCCATGAGGG - Intergenic
938844438 2:135194432-135194454 AAGACAGCACCAAGCGATGAGGG + Intronic
939132638 2:138255732-138255754 TATAAAACAACAAGTCATCAGGG + Intergenic
939261697 2:139818854-139818876 AGGACAGCACCAAGCCATGAGGG - Intergenic
939297221 2:140282843-140282865 TAGAAAACACCCAACCATCAAGG + Intronic
939364522 2:141215096-141215118 AGGACAGCACCAAGCCATAAGGG - Intronic
940194710 2:151080755-151080777 TGGAAAACACCAAGACATGAAGG + Intergenic
940201551 2:151156881-151156903 CAGACATAACCAACCCATCAAGG - Intergenic
940290596 2:152074429-152074451 TAACCATCACCAAGCCATCGTGG + Intronic
940507186 2:154570676-154570698 AAGACAGCACCAAGCCATGAGGG - Intergenic
942519273 2:176786112-176786134 AGGAGAACACCAAGCCATGAGGG - Intergenic
943004925 2:182377222-182377244 AAGACAGCACCAAGCCAGGAGGG - Intronic
943077710 2:183216622-183216644 GAGACAGCACCAAGCCATGAAGG - Intergenic
943271406 2:185810293-185810315 AAGACAGCACCAAGCCATGAAGG - Intronic
943603140 2:189944238-189944260 AAGACAGCACCAGGCCTTCATGG - Intronic
943753159 2:191531133-191531155 AAGACAGCACGAAGCCATGAGGG + Intergenic
943889638 2:193270725-193270747 ATGACAGCACCAAGCCATGAGGG + Intergenic
944119538 2:196226147-196226169 AAGATAGCACCAAGCCATAAGGG - Intronic
944980018 2:205106696-205106718 AATAAAACACCAAGGCATCAGGG - Intronic
945410116 2:209497789-209497811 AAAACAGCACCAAGCCATAAGGG + Intronic
947895196 2:233664674-233664696 AGGACAACACAAAGCCATGAGGG + Intronic
948046322 2:234948119-234948141 GGGACAGCACCAAGCCATGAGGG + Intergenic
948380933 2:237549612-237549634 TTGTCACCACCAAGCCTTCAAGG - Intronic
948875392 2:240824230-240824252 TGGACCACAGGAAGCCATCACGG - Intergenic
1169467220 20:5851927-5851949 AGGACAGCACCAAGCCATGAGGG - Intronic
1169680314 20:8204534-8204556 AAGACAACACCAAGCCATGAGGG - Intronic
1170251023 20:14282831-14282853 AAGACAGCACCAGGCCATGAGGG + Intronic
1170439054 20:16359264-16359286 AAGACTGCACCAAGCCATAAGGG - Intronic
1170750734 20:19142422-19142444 AAGAGAACACAAAGTCATCATGG - Intergenic
1171157914 20:22893507-22893529 AAGACAGCACTAAGCCATGAGGG - Intergenic
1171285006 20:23929794-23929816 AGGACAACACCAAGCCATGAGGG - Intergenic
1171370110 20:24656907-24656929 AGGACAGCACCAAGCCATGAGGG - Intronic
1173067810 20:39729687-39729709 AAGACAGCACCAAACCATGAGGG - Intergenic
1173131189 20:40395304-40395326 AAGACAACAGCAAGCAGTCATGG - Intergenic
1173374501 20:42471373-42471395 AAGACAGCACCAACCCATGAGGG - Intronic
1173669165 20:44785892-44785914 CAGACAACACCAATCAATCAAGG - Intronic
1173768844 20:45640276-45640298 AGGACAGCACCAAGCCATGAGGG + Intergenic
1174073919 20:47918648-47918670 AAGATAGCACCAAGCCATGAGGG - Intergenic
1174339650 20:49887797-49887819 GAGACACAACCAAGCCGTCAGGG - Intronic
1175343962 20:58256854-58256876 AGGACAACACCAAGCAATAAGGG - Intergenic
1175555691 20:59854302-59854324 AAGACAGCACCAAGCCATGAGGG - Intergenic
1175645423 20:60666892-60666914 AAGACAGCACCAAGCCAAGAGGG + Intergenic
1176224713 20:63990207-63990229 AGGACAGCACCAGGCCATCAGGG + Intronic
1176457633 21:6928108-6928130 TAGACAGCACCAGCCCCTCAAGG + Intergenic
1176727339 21:10449866-10449888 AGGACAGCACCAAGCCATGAGGG + Intergenic
1176835805 21:13793192-13793214 TAGACAGCACCAGCCCCTCAAGG + Intergenic
1177043296 21:16139570-16139592 AAGACAGCACCAAGCCATGAGGG + Intergenic
1177206197 21:18014593-18014615 AGGACAGCACCAAGCCATGAAGG - Intronic
1177206719 21:18018409-18018431 AAGACAGCACCAAGCCATGAGGG - Intronic
1177406225 21:20672193-20672215 AAGACACCACCAAGCCACGAGGG - Intergenic
1177565648 21:22818061-22818083 AAGACAGCACCAAGCCATGCAGG + Intergenic
1177703354 21:24667651-24667673 TACACGGCACCATGCCATCAAGG + Intergenic
1178029087 21:28504620-28504642 AAGACAGCACCACGCCATGAGGG + Intergenic
1178324434 21:31632334-31632356 AAGATAGCACCAAGCCATGAAGG - Intergenic
1178415352 21:32400450-32400472 AAGACTGCACCAAGCCATGAGGG - Intergenic
1180287060 22:10757159-10757181 AGGACAGCACCAAGCCATGAGGG - Intergenic
1180409675 22:12593787-12593809 TGGATATCACCAAGCCATGAGGG + Intergenic
1180871058 22:19147717-19147739 TGGATAACACCAAGCAAGCATGG - Intergenic
1181104768 22:20567668-20567690 TAGACATCTCCAAGCCACTAGGG - Intronic
1181104781 22:20567735-20567757 TAGACATCTCCAAGTCACCAGGG - Intronic
1182009106 22:26985508-26985530 CAGGAAACATCAAGCCATCAAGG - Intergenic
1182866612 22:33609784-33609806 AGGACAGCACCAAGCCATGAGGG - Intronic
1182866897 22:33611838-33611860 AGGACAGCACCAAGCCATTAGGG - Intronic
1183771040 22:39926022-39926044 TAGACAATTGCAAGACATCATGG - Intronic
1183847653 22:40555357-40555379 TGGACAGCACCAATCCATGAGGG - Intronic
949113568 3:292845-292867 TGGACAGCACCCAGCCATGAGGG + Intronic
949270534 3:2211257-2211279 AAGACAACAGCAAGCCATGAGGG + Intronic
949772824 3:7597295-7597317 AAGACAGCACCAAGCCATGAGGG + Intronic
950310920 3:11956982-11957004 AAGACAGCACCAAGCCATGAAGG - Intergenic
950776218 3:15352594-15352616 AAGACAGCACCAAGCCATTAGGG - Intergenic
950870598 3:16225207-16225229 AAGACAGCACGAAGCCATGAGGG + Intronic
951440355 3:22715585-22715607 TAGAGAAGAGCATGCCATCAAGG + Intergenic
951934170 3:28003171-28003193 AGGACAGCACCAAGCCATGAGGG + Intergenic
952016699 3:28965269-28965291 GAGACAGCACTAAGCCATGAGGG - Intergenic
952042032 3:29272393-29272415 AAGACAGTACCAAGCCATGAGGG + Intergenic
952132653 3:30383377-30383399 AAGACAACACCAAGCCATGAGGG - Intergenic
952139291 3:30459969-30459991 GGGATAACACCAAGCCATGAGGG - Intergenic
952546087 3:34420876-34420898 AGGATAACACCAAGCCATGAAGG - Intergenic
955148961 3:56347833-56347855 AAGACAACACTAAGGAATCATGG - Intronic
955167138 3:56525874-56525896 AGGACAGCACCAAGCCATGAGGG - Intergenic
955241576 3:57182952-57182974 CAGACAACCCCAAGCCTGCAGGG + Intergenic
955508128 3:59652340-59652362 TAAACACCAAAAAGCCATCAAGG + Intergenic
955692369 3:61603308-61603330 TAGACAGCACCAAACCACAAAGG - Intronic
956004450 3:64763535-64763557 AGGACAACATCAAGCCATGAGGG + Intergenic
956238432 3:67102786-67102808 AGGACACCACCAAGCCATGAGGG - Intergenic
956311200 3:67882511-67882533 AGGACAGCACCAAGCCATGAGGG - Intergenic
956327745 3:68071881-68071903 AAGATAGCACCAAGCCATGAGGG + Intronic
957188979 3:76981920-76981942 CAGGCAGCACCAAGCCATGAGGG + Intronic
957599959 3:82321186-82321208 TAGACAGCACCAAGCCATGAGGG + Intergenic
957715572 3:83926281-83926303 AAGATAGCACCAAGCCATGAGGG - Intergenic
957772727 3:84715309-84715331 AAGACAGCACCAAGTCATGAGGG - Intergenic
958688803 3:97433902-97433924 TAGAAAGCACCAAGCCATGGGGG - Intronic
959050946 3:101524735-101524757 AAGACAGCACCAAGCTATGAGGG - Intergenic
960032392 3:113067833-113067855 AAGACAGCACCAAGCCATGAGGG + Intergenic
961416280 3:126760062-126760084 AGGACAGCACCAAGCCATGAAGG + Intronic
961672221 3:128541571-128541593 AGGACAGCACCAAGCCATGAGGG - Intergenic
961765001 3:129203145-129203167 AGGACAGCACCAAGCCATGAGGG - Intergenic
962005465 3:131344839-131344861 AGGACAGCACCAAGCCATGAGGG + Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
963334849 3:143963096-143963118 AAGACAGCACCTAGCCATGAGGG + Intergenic
963382313 3:144546829-144546851 TTGAGAACTCTAAGCCATCAGGG + Intergenic
964061022 3:152522876-152522898 ACGACAGCACCAAGCCATGAGGG + Intergenic
964135633 3:153341910-153341932 AAGACAGCACCAAGCCATGAGGG - Intergenic
964327751 3:155565389-155565411 AAGACAGCACCAAGCCTTGAGGG - Intronic
964342126 3:155718711-155718733 AGGACATCACCAAGCCATGAGGG + Intronic
965030961 3:163367395-163367417 AAGACAGCACCAAGCCATGAGGG - Intergenic
966114294 3:176443564-176443586 AGGACAGCACCAAGCCATGAGGG - Intergenic
966400049 3:179538639-179538661 AAGATAGCACCAAGCCATGAGGG + Intergenic
966550384 3:181198708-181198730 AGGACAGCACCAAGCCATGAGGG + Intergenic
967329520 3:188276579-188276601 AAGACATCACCAAGTCATGAGGG - Intronic
967526774 3:190504141-190504163 AAGACAGCACCAAGCTATGAGGG + Intergenic
967632050 3:191755825-191755847 AAGACAGCACCAAGTCATTAGGG + Intergenic
967805819 3:193713729-193713751 AAGACAGCACCAAACCATGAGGG - Intergenic
967806104 3:193715795-193715817 AAGACAACACCATGCCATGAGGG - Intergenic
967812044 3:193768702-193768724 AAGACAGCACCAAGCCGTGAGGG - Intergenic
968166779 3:196472570-196472592 AAAACAAGACCAAGCAATCATGG - Exonic
969552972 4:7884032-7884054 AGGACAGCACCAAGCCATGAGGG - Intronic
969828306 4:9775556-9775578 AAGACAGCACCAAGCCATGGGGG - Intronic
969896911 4:10313833-10313855 AGGACAGCACCAAGCCATGAGGG - Intergenic
969923997 4:10568636-10568658 TTGACAACAGCCAGCCAGCAGGG + Intronic
970146134 4:13038040-13038062 AAGAGAGCACCAAGCCATGAGGG - Intergenic
970357051 4:15265411-15265433 AAGGCAACAGCAAGCCATAACGG - Intergenic
970791271 4:19860703-19860725 AAGACAACACCAAGCCATGAGGG - Intergenic
970971921 4:21994814-21994836 AGGACAACACCAAGCCATGAGGG + Intergenic
971048716 4:22835546-22835568 AAGACAACATCAAGCCCTAAGGG + Intergenic
971494591 4:27250542-27250564 GGGACAGCACCAAGCCATGAGGG + Intergenic
971566252 4:28145276-28145298 AAGACAGCACCAAACCATTAGGG + Intergenic
971585037 4:28394622-28394644 AGGACAGCACCAAGCCATGAGGG - Intronic
972196053 4:36655338-36655360 AAGGCAGCACCAAGCCATGAGGG + Intergenic
972385463 4:38561493-38561515 AAGACAGCACCAAGCCACGAGGG - Intergenic
972701308 4:41496632-41496654 TACACAAAACCTAGCCATAAGGG - Intronic
972911380 4:43821785-43821807 AAGACAGCACCAAACCATGAAGG + Intergenic
973273933 4:48289130-48289152 AAGACAGCACGAAGCCATGAGGG - Intergenic
973533809 4:51860727-51860749 AAGACAGCACTAAGCCATGAGGG + Intronic
973614079 4:52661835-52661857 AAGACAGCACCAAGCCATGAGGG - Intergenic
973626590 4:52778741-52778763 AAGACAGCACCAAGCCATGAGGG + Intergenic
974192122 4:58519018-58519040 AAGACAGCACCAAGCTATGAGGG + Intergenic
974510546 4:62834713-62834735 AAGACAGCACCAAGCCATGAGGG - Intergenic
975143750 4:70944850-70944872 TAGACATCACCAAGCCATGAAGG + Intronic
975435144 4:74343452-74343474 AGGACAGCACCAAGCCATGAGGG + Intergenic
975859743 4:78663965-78663987 AAGACAGCACCAAGCCATGAGGG - Intergenic
975940876 4:79644223-79644245 AAGACAGCACCAAGCCATAACGG + Intergenic
976453643 4:85220259-85220281 AGGACAGCACCAAGCCATGAGGG - Intergenic
976533540 4:86184609-86184631 AGGACAACACCAAGCCACAAGGG - Intronic
976847463 4:89506359-89506381 TAGACAACACCAAAGCTTTAGGG - Intergenic
976946871 4:90781106-90781128 AAGACAGCACCCAGCCATGAGGG + Intronic
977445465 4:97125982-97126004 AGGACAGCACCAAGCCATGAGGG - Intergenic
977739768 4:100464990-100465012 AAGAAAACCCCAAGCCATGATGG - Intronic
977983217 4:103350466-103350488 AAGATAGCACCAAGCCATAAGGG - Intergenic
978017069 4:103757653-103757675 AGGACAGCACCAAGCCATGAGGG + Intergenic
978178053 4:105758390-105758412 AAGACAGCACCAAGACATGAGGG - Intronic
978484078 4:109230072-109230094 AAGACACCACGAAGCCATGAGGG + Intronic
978627980 4:110709200-110709222 AGGACAACACCAAGCCATGAGGG - Intergenic
978926052 4:114246170-114246192 AAGACAGCACCAAGCCATAAGGG + Intergenic
979710936 4:123778625-123778647 AAGACAGCAGCAAGCCATGAGGG - Intergenic
979891045 4:126095652-126095674 AAGACAGCACCAAGCCCTGAGGG + Intergenic
980614090 4:135195250-135195272 AGGACAGCACCAAGCTATCAGGG - Intergenic
981150740 4:141377072-141377094 TAGTCAACACCAAGCCCAAAAGG - Intergenic
981695064 4:147551606-147551628 AAAACAGCACCAAGCCATGAGGG + Intergenic
983351604 4:166597377-166597399 AAGACAGCACCAAGCCATGAGGG - Intergenic
983434397 4:167694032-167694054 AAGACAACACCAACTCATGAAGG + Intergenic
985056063 4:186036505-186036527 AGGACAGCACCAAGCCATAAGGG - Intergenic
985199159 4:187466522-187466544 AGGACAGCACCAAGCCATGAGGG + Intergenic
985555760 5:557217-557239 TGGACAACACCCAGCAATCAAGG + Intergenic
985769979 5:1803404-1803426 TAGACATCACTAATCAATCATGG - Intronic
986136003 5:4978512-4978534 AAGACAGCACCAAGCCTTGAGGG - Intergenic
986488432 5:8264566-8264588 GAGACAGCACCAAGCCAAGAGGG - Intergenic
986817986 5:11433716-11433738 GAGACAGCACCAAGCCATGAGGG + Intronic
986926949 5:12766324-12766346 GGGACAGCACCAAGCCATGAAGG - Intergenic
986926953 5:12766345-12766367 AAGACAGCACCAAGCCATGAGGG - Intergenic
986934478 5:12866321-12866343 AGGACAACACCAAGACATGAGGG - Intergenic
986949044 5:13059768-13059790 AAGACAGCACCAAGGCATAAGGG + Intergenic
986949285 5:13061900-13061922 AAGACAGCACCAAGCCATAAGGG + Intergenic
987213232 5:15706222-15706244 AAGACAACACCAAGCCATGAAGG - Intronic
987215487 5:15732783-15732805 TAGAAAACAAAATGCCATCAAGG + Intronic
987955954 5:24740155-24740177 AAGACAGCACCAAGCGATGAGGG - Intergenic
988302625 5:29450447-29450469 GAGACAGCACCAAGCCACGAAGG - Intergenic
988865562 5:35330831-35330853 ATGACAGCACCAAGCCATAAGGG - Intergenic
988876816 5:35456180-35456202 AGGACAGCACCAAGCCATGAGGG - Intergenic
989228935 5:39065320-39065342 AAGACAGCACCAAGCCATGAGGG + Intronic
989229222 5:39067350-39067372 AAAACAACACCAAGCCATCAGGG + Intronic
989545761 5:42671365-42671387 AGGACAGCACCAAGCCATAAGGG + Intronic
990439693 5:55832286-55832308 AAGACAGCACAAAGCCATGATGG - Intergenic
990560848 5:56981376-56981398 AAGACAGCACCAAGCCATGGGGG - Intergenic
991015850 5:61931544-61931566 TAGACAACATCCAGACAGCAGGG + Intergenic
991643662 5:68779145-68779167 ACGACAGCACCAAGCCATTAGGG + Intergenic
991776487 5:70090304-70090326 AAGGTAACACCAAGCCATGAGGG - Intergenic
991855774 5:70965751-70965773 AAGGTAACACCAAGCCATGAGGG - Intergenic
991869789 5:71098529-71098551 AAGGTAACACCAAGCCATGAGGG - Intergenic
992334240 5:75748984-75749006 AAGACAGCACCAAGCCATGAGGG - Intergenic
992375375 5:76183342-76183364 AAGACAGCACCAAGACATAAAGG + Intronic
992781598 5:80133031-80133053 AAGACAGCACCAAGCCATGAGGG - Intronic
993126006 5:83836335-83836357 CAGACAGTACCAAGCCATGAGGG - Intergenic
993262725 5:85680605-85680627 AAGACAGCACCAAGCAATGAGGG - Intergenic
993505284 5:88701474-88701496 AAGACAGCACCAAGCCATGAGGG - Intergenic
993638529 5:90374415-90374437 AAGACAGCACCAAGCCATGAGGG + Intergenic
993809694 5:92460365-92460387 TACACAAGGCCAAGCCATAATGG - Intergenic
993844868 5:92928976-92928998 TAAGCAAGACCAAGCCTTCATGG + Intergenic
994209121 5:97068572-97068594 AAGATATCACCAAGCCATGAGGG - Intergenic
994449033 5:99917262-99917284 AAGACAGCACCAAGCCATAAGGG - Intergenic
994500051 5:100563974-100563996 AGGACAGCACCAAGCCATGAGGG - Intronic
994520961 5:100834667-100834689 AGGACAGCACCAAGCCATAAGGG - Intronic
994585483 5:101703780-101703802 AAGACAGCACCAAGCAATGAGGG + Intergenic
995066089 5:107864585-107864607 AAGACAGCACCAAGCCATGATGG - Intronic
995460787 5:112400616-112400638 AAGACAGGACCAAGCCATGAGGG + Intronic
995789305 5:115866678-115866700 TACACAACAGCAAATCATCAGGG + Exonic
995911495 5:117193118-117193140 AAGACAGCACCAAGCCATGAGGG - Intergenic
996167705 5:120245432-120245454 AAGACAGCACCAAGCCGTGAGGG - Intergenic
996536415 5:124582439-124582461 TCATCAAAACCAAGCCATCACGG + Intergenic
997032685 5:130149515-130149537 AAGACAGCACCAAGCCATAAGGG + Intronic
997142688 5:131399479-131399501 AAGACAGCACCAAGCCATGAGGG + Intergenic
997815569 5:137014077-137014099 AAGACAGCACCAAGCCATGAGGG - Intronic
998018412 5:138751222-138751244 AGGACAGCACCAAGCCATGAGGG + Intronic
999700956 5:154227949-154227971 AAGACAGCACCAAGCCATGAGGG - Intronic
999817983 5:155197058-155197080 AAGACAGCACCAAGCCTTGAGGG - Intergenic
999838256 5:155397816-155397838 AAGACAGCACCAAGCCATGAGGG + Intergenic
999917559 5:156279864-156279886 CACACAACACCAAGTCATGATGG + Intronic
1000418156 5:161005804-161005826 AAGACAGCACCAAGCCACGAGGG - Intergenic
1000585381 5:163091112-163091134 AAGACAGCATCAAGCCATAAGGG + Intergenic
1000733540 5:164868496-164868518 TGGAAAACACTAAGCAATCAGGG + Intergenic
1000980449 5:167811301-167811323 AGGACAGCACCAAGCCATGAGGG - Intronic
1001418252 5:171564216-171564238 AAGACAGCACCAAGCCACGAGGG - Intergenic
1002008574 5:176257571-176257593 AAGACAGCACCAAGCCATGAGGG + Intronic
1002218148 5:177654680-177654702 AAGACAGCACCAAGCCATGAGGG - Intergenic
1003014582 6:2457720-2457742 CAGACCACACCAAGCCAGAATGG - Intergenic
1003375407 6:5572372-5572394 AAGACAGCACCAAGCCATGAAGG + Intronic
1003977941 6:11361528-11361550 AATACAGCACCAAGCCATGAGGG + Intronic
1004047531 6:12040940-12040962 AAGACAGTACCAAGCCATGAGGG + Intronic
1004400971 6:15288381-15288403 AGGACAGCACCAAGCCATGAGGG + Intronic
1004551652 6:16653815-16653837 TAAGCAACATCAAGCCATGAGGG - Intronic
1004767461 6:18746445-18746467 GAGAAAACACCAAGCATTCAGGG - Intergenic
1004887643 6:20067082-20067104 AAAACATCACCAAGCCATGAGGG + Intergenic
1004918712 6:20356404-20356426 GAGATAGCACCAAGCCATGAGGG - Intergenic
1005221308 6:23591922-23591944 AAGACAGCACCAAGCCAAGAGGG - Intergenic
1008518785 6:52343554-52343576 AAGAGAGCACCAAGCCATGAAGG - Intergenic
1008553383 6:52654721-52654743 AAGACAGCACCAAGCCATGAGGG - Intergenic
1009005913 6:57786353-57786375 GAGACAGCACCAAGCCACGAAGG - Intergenic
1010525534 6:76895715-76895737 AAGACATCACCAAGCCATGAGGG - Intergenic
1011719039 6:90136082-90136104 CAGACATCACCTAGCCACCAGGG + Intronic
1012114921 6:95285023-95285045 TAGACATCACAAAGCCAGCTTGG - Intergenic
1012130329 6:95482871-95482893 AAGACGGCACCAAGCCATGAGGG - Intergenic
1012760713 6:103297093-103297115 AAGACAGCATCAAGCCATGAGGG + Intergenic
1013126640 6:107190876-107190898 TAGACAACACAGAGCAATGAAGG + Intronic
1013133886 6:107261302-107261324 AAGACAGCACCAAGCCATAAGGG - Intronic
1014073623 6:117211978-117212000 AAGACAGCACTAAGCTATCAGGG + Intergenic
1014703973 6:124724098-124724120 GAGCCAACACCAAGGCAGCAAGG + Intronic
1014893663 6:126873061-126873083 GAGAAAGCACCAAGCCATAAGGG - Intergenic
1015662458 6:135590591-135590613 AAGAGATCACCAAGCCATAAAGG + Intergenic
1015662498 6:135590915-135590937 AAGACAGCACCAAGCAATGAGGG + Intergenic
1015979734 6:138826793-138826815 AAGACAGCACCAAACCATGAGGG - Intronic
1016243631 6:141958943-141958965 AGGACAGCACCAAGCCATGAAGG + Intergenic
1016564243 6:145434903-145434925 AGGACAGCACCAAGCCATGAGGG - Intergenic
1016669155 6:146681197-146681219 AAGACAGCACCAAGCCATGAGGG - Intronic
1017189839 6:151641264-151641286 AGGACAGCACCAAGCCATGAGGG - Intergenic
1018236064 6:161724903-161724925 AAGACAGCACCAAGCCATGAGGG - Intronic
1018510410 6:164518771-164518793 AAGACAGCAGCAAGCCATGAGGG - Intergenic
1018645173 6:165941555-165941577 AAGACAGCACCAAGCCGTGAGGG - Intronic
1018658468 6:166063330-166063352 AAGACAGCACCAAGCCACAAGGG - Intergenic
1018805080 6:167252904-167252926 AAGACAGCATCAAGCCATGAGGG - Intergenic
1019063256 6:169273600-169273622 AGGACAGCACCAAGCCATGAAGG - Intergenic
1019089571 6:169517098-169517120 AAGACAGCATCAAGCCATGAAGG - Intronic
1020414090 7:7925888-7925910 CAGACAGCACCAAGCCATGAGGG - Intronic
1020568092 7:9822697-9822719 TAGACATCATCGAGCCAGCAGGG + Intergenic
1022060439 7:26787772-26787794 GGGACAGCACCAAGCCATGAGGG + Intronic
1022141428 7:27496369-27496391 AGGACAGCACCAAGCCATGAGGG + Intergenic
1022511175 7:30935708-30935730 TACACATCACCAAGCCACCCAGG + Intergenic
1022548311 7:31209875-31209897 AGGACAGCACCAAGCCATGAGGG + Intergenic
1023368895 7:39492234-39492256 AACACAAAACCAAGCCACCATGG + Intronic
1023391192 7:39713306-39713328 AAGACAGCACCAAGCCATGAGGG - Intergenic
1023524784 7:41089215-41089237 TAGAAAACACCAGGCCAAGATGG - Intergenic
1023524811 7:41089454-41089476 AAGTTAACACCAAGCCATGAGGG - Intergenic
1023641233 7:42261308-42261330 AAGACATCACCAAACCATGAGGG + Intergenic
1023698113 7:42868063-42868085 AAGACAGCATCAAGCCATGAGGG - Intergenic
1023714857 7:43033632-43033654 ATGACAGCACCAAGCCATGAGGG + Intergenic
1023716720 7:43052401-43052423 AGGACAGCACCAAGCCATCAGGG - Intergenic
1023985939 7:45095984-45096006 AAGACAGCACCAAACCATGAGGG - Intergenic
1024383064 7:48722076-48722098 AAGACAGCACTAAGCCATGAAGG + Intergenic
1024596941 7:50946486-50946508 AGGACAGCACCAAGCCATGAGGG + Intergenic
1024724602 7:52178136-52178158 TAGACACTATCAGGCCATCAGGG - Intergenic
1026249619 7:68658137-68658159 AAGACAGCACCAAGCCATGCGGG + Intergenic
1026385326 7:69841411-69841433 AAGACAGCACCAAGCCATGAAGG + Intronic
1026530176 7:71190310-71190332 AAGACAGCACCAAGCCATGAGGG - Intronic
1026576623 7:71577451-71577473 TTGACACCAGTAAGCCATCATGG + Intronic
1027405668 7:77857325-77857347 GAGACAACCACAGGCCATCATGG + Intronic
1027528616 7:79301839-79301861 AAGACAGCACCAAGCCATGAAGG - Intronic
1027954679 7:84863261-84863283 AAGACAGCAGCAAGCCATGAGGG + Intergenic
1028792180 7:94865459-94865481 AGGACAGCACCAAGCCATGAGGG - Intergenic
1030491989 7:110248588-110248610 TATAGAACACCAAACCATTAAGG + Intergenic
1030513340 7:110512411-110512433 AAGACAGCACCAAGTCATGAGGG + Intergenic
1030738176 7:113075915-113075937 CAGACAACACCAAGCTGGCATGG + Intergenic
1030799922 7:113837293-113837315 AAGACAGCACCAAGCCATGAGGG - Intergenic
1031310725 7:120194174-120194196 AAGACAGCACCAAGCCATGAGGG + Intergenic
1031872372 7:127101455-127101477 AAGATAGCACCAAGCCATGAGGG - Intronic
1032388700 7:131541789-131541811 TAAACAAAGCCAAGTCATCATGG + Intronic
1032943810 7:136826909-136826931 AAGACAGCACCAAGTCATGAGGG - Intergenic
1033028407 7:137800362-137800384 AGGACAGCACCAAGCCATGAGGG - Intronic
1033400269 7:141016153-141016175 TATACAAAACGAAGCCAACAAGG - Intergenic
1033542108 7:142366721-142366743 AAGACAGCACTAAGCCATGAGGG + Intergenic
1033763411 7:144461540-144461562 AAGACAGCACCAAGCCACGAGGG - Intronic
1033784961 7:144718748-144718770 AGGACAGCACCAAGCCATGAGGG - Intronic
1033843626 7:145404548-145404570 AGGACAACACCAAACCATGAGGG - Intergenic
1034602764 7:152278115-152278137 AGGACAGCACCAAGCCATGAGGG - Intronic
1034710254 7:153185013-153185035 AAGACAACAAAAAGCCATGAGGG + Intergenic
1034710534 7:153187251-153187273 AACACAGCACCAAGCCATGAGGG + Intergenic
1034725644 7:153332862-153332884 AAGAAAGCACCAAGCCATGAGGG + Intergenic
1035864880 8:3071117-3071139 AAGATAGCACCAAGCCATGAAGG + Intronic
1037364172 8:18104641-18104663 AAGACAGCACCAAGCCATGAGGG - Intergenic
1037480468 8:19300709-19300731 AGGACAACACCAAGACATGAGGG + Intergenic
1038278510 8:26141790-26141812 AGGACAACACCAAGCCATAAGGG - Intergenic
1038460669 8:27713924-27713946 AAGACAGCACCAAGCCATGAGGG - Intergenic
1038693804 8:29787046-29787068 AAGACAGCACCAAGCCATGAGGG - Intergenic
1038968693 8:32606517-32606539 TACAAAACACAAAGCCATCGGGG - Intronic
1039390361 8:37175797-37175819 AGGACAACACCAAACCATGAGGG + Intergenic
1039535924 8:38312586-38312608 AAGACAGCACCAAGCCATGTGGG - Intronic
1039652703 8:39359481-39359503 AAGATAGCACCAAGCCATGAGGG - Intergenic
1039671415 8:39604516-39604538 AGGACAGCACCAAGCCATGAGGG - Intronic
1040614371 8:49019804-49019826 AAGACAGCACCAAGCCATGAGGG + Intergenic
1040984765 8:53281362-53281384 AAAACAGCACCAAGCCATAAGGG - Intergenic
1041065554 8:54079435-54079457 TAGACATTACCAAGCAATTAAGG + Intronic
1041140579 8:54814459-54814481 TAGAGAACAAGAAGCCATAATGG + Intergenic
1041548893 8:59078382-59078404 AAGACAGCACCAAGCCATGAGGG - Intronic
1042247524 8:66722923-66722945 AAGACAGCACCAAGCCATGAGGG + Intronic
1042747270 8:72121229-72121251 TAGGCAACCCCAAGGCAGCAGGG - Intergenic
1043178844 8:77057987-77058009 AAGACAGCACCAAGCCATGAGGG + Intergenic
1043246279 8:78006119-78006141 TACATGCCACCAAGCCATCATGG - Intergenic
1043334340 8:79155575-79155597 ATGACAGCACCAAGCCATAAGGG - Intergenic
1043384104 8:79731438-79731460 AAGACAGCACTAAGCCATGAGGG + Intergenic
1043618940 8:82163850-82163872 TAAAAAACAGCAAGGCATCAGGG + Intergenic
1043788894 8:84437713-84437735 AAGACAGCACCAAATCATCAGGG - Intronic
1044168282 8:89016941-89016963 AAGACAGCACCAAACCATGAGGG - Intergenic
1045597446 8:103672627-103672649 AAGATAGCACCAAGCCATGAGGG + Intronic
1045616122 8:103913821-103913843 AAGACAGCACCAAGCCACAAGGG + Intronic
1045653181 8:104361727-104361749 TAGATAACATGAAGCCAACAAGG + Intronic
1045791197 8:105986887-105986909 AGGACAGCACCAAGCCATGAGGG - Intergenic
1045817596 8:106294680-106294702 AAGACAACACCAAGCCATGAAGG + Intronic
1046054327 8:109061107-109061129 AAGACAGCACCAAGCCAGAAGGG + Intergenic
1046214635 8:111127347-111127369 AAGACAGCACCAAGCCACAAGGG + Intergenic
1046391931 8:113585846-113585868 AAGACAGCACAAAGCCATGAGGG + Intergenic
1046451836 8:114402826-114402848 AAGACAGCACCAAGCCACGAAGG - Intergenic
1046680985 8:117169816-117169838 AAGACAGCACCAAGCCATGAGGG + Intronic
1046692274 8:117299097-117299119 AAGACAGCACCAAGCCATGAGGG - Intergenic
1046766584 8:118075862-118075884 AGGACAGCACCAAGCCATGACGG + Intronic
1046830379 8:118739130-118739152 TAGACAGCACCATGCAATTAGGG - Intergenic
1047126051 8:121961821-121961843 AAGACATCACCAAGCCATGAGGG - Intergenic
1047393194 8:124470969-124470991 AGGACAACACCAAGCCATCAGGG - Intergenic
1047530977 8:125675029-125675051 AAGACAGCACCAAGCCATGAGGG + Intergenic
1048103654 8:131383230-131383252 AAAACAGCACCAAGCCATGAAGG + Intergenic
1048506765 8:135028672-135028694 AAGACAGCACCGAGCCATGAGGG - Intergenic
1048635587 8:136291921-136291943 AAGACAACACCAAGCCATGAAGG + Intergenic
1048733425 8:137470364-137470386 AGGACAGCACCAAGCCATGAGGG - Intergenic
1048735811 8:137500372-137500394 AAGACAGTACCAAGCCATTAAGG + Intergenic
1049484071 8:142842432-142842454 ATGACAAAACCATGCCATCAAGG - Intronic
1050029223 9:1367551-1367573 AAGACAGCACCAAACCATGAGGG + Intergenic
1050068980 9:1790763-1790785 AAGACAGCACCAAGCCATGAGGG - Intergenic
1050597225 9:7216089-7216111 CAGACAACAGGAAGCCATTATGG - Intergenic
1051920828 9:22261144-22261166 AATACAGCACCAAGCCATGAGGG - Intergenic
1052785569 9:32824946-32824968 TAGACAACATCAAGGCATTTTGG + Intergenic
1054906238 9:70416149-70416171 TAAAAAACTCCAAGCCATCTTGG + Intergenic
1055762180 9:79620960-79620982 AAGACAACATCAGGCCATGAAGG + Intronic
1055962859 9:81836880-81836902 AAGACAGCACCAAGCCATGAAGG + Intergenic
1055982203 9:82015292-82015314 AAGATAGCACCAAGCCATGAGGG - Intergenic
1056054163 9:82803453-82803475 AAGACAGCACCAAGCCACGAGGG - Intergenic
1056318506 9:85414862-85414884 GAGACAGCAGGAAGCCATCAGGG + Intergenic
1056903803 9:90627013-90627035 AAGATAGCACCAAGCCATAAGGG - Intronic
1059008697 9:110432973-110432995 AGGACAGCACCAAGCCATGAGGG - Intronic
1059884946 9:118735575-118735597 AGGACAGCACCAAGCCATAAGGG - Intergenic
1060109816 9:120898754-120898776 TAGAGAACACCCAGTCTTCAAGG - Intergenic
1060755784 9:126212349-126212371 AAGACAGCACCAAACCATGAGGG - Intergenic
1061651509 9:132054199-132054221 AGGACAGCACCAAGCCATGAGGG - Intronic
1061759880 9:132843214-132843236 AAGACAGCACCAAACCATGAGGG - Intronic
1186157198 X:6737853-6737875 TCGACAGCACAAAGCCCTCAAGG - Intergenic
1186718137 X:12275163-12275185 AAGACAGCACCAAGCCATGAGGG - Intronic
1187083419 X:16015667-16015689 AAGACAGCACCAAGCCATGAGGG + Intergenic
1187946311 X:24429244-24429266 AAGACAGCACCAAGCCATGAGGG - Intergenic
1188381326 X:29496369-29496391 AAGACAACACCAAGCCATGAGGG - Intronic
1188754112 X:33939069-33939091 AAGATAACACCAAGCCATGAAGG - Intergenic
1188776116 X:34221052-34221074 ATGACAACACCAAGCCATGAAGG + Intergenic
1189353031 X:40291328-40291350 AAGACAGCACCAAGCCATGAGGG + Intergenic
1190103191 X:47538781-47538803 AGGACAGCACCAAGCCATGAAGG - Intergenic
1190221193 X:48513398-48513420 TAGACAACACCAAGCCATCAGGG - Intronic
1190425088 X:50328498-50328520 AGGACAGCACCAAGCCATGAGGG + Intronic
1190526030 X:51330922-51330944 CAGACAGCACCAAGCCATGAGGG + Intergenic
1190543439 X:51500748-51500770 CAGACAGCACCAAGCCATGAGGG - Intergenic
1192579370 X:72268138-72268160 TAGATAGCACCAACCCATAACGG - Intronic
1193271409 X:79533896-79533918 AAGACAGCACCAAGCCATGAGGG + Intergenic
1193271629 X:79535930-79535952 AAGACAACGCCAAGCAATGAGGG + Intergenic
1193390338 X:80919726-80919748 AAGACAGCAGCAAGCCATGAGGG - Intergenic
1193498708 X:82244851-82244873 AAGACAGCACCAAGCCATGAGGG + Intergenic
1193724682 X:85025244-85025266 AAGACAACACCAAGCCATAAGGG + Intronic
1193724959 X:85027277-85027299 AAGACAGCACCAAGCCATGAGGG + Intronic
1193862352 X:86685819-86685841 AAGACAGCACGAAGCCATAAGGG + Intronic
1194235870 X:91382448-91382470 AAAACAGCACCAAGCCATGAGGG - Intergenic
1194468935 X:94268494-94268516 AAGACAGCACCAAGCTATGAGGG - Intergenic
1194949418 X:100107236-100107258 AAGACCATACCAAGCCATGAGGG - Intergenic
1196459021 X:115911034-115911056 ATGACAGCACCAAGCCATGAGGG + Intergenic
1196823729 X:119724501-119724523 AGGACAGCACCAAGCCATGAAGG + Intergenic
1196834731 X:119803540-119803562 AGGACAGCACCAAGCCATGAGGG - Intergenic
1196835886 X:119813317-119813339 AGGACAGCACCAAGCCATGAGGG - Intergenic
1196836822 X:119821078-119821100 AGGACAGCACCAAGCCATGAGGG - Intergenic
1196837923 X:119830327-119830349 AGGACAGCACCAAGCCATGAAGG - Intergenic
1197241026 X:124123362-124123384 AAGATAACACCAAGCCATGAGGG - Intronic
1197379074 X:125716026-125716048 AGGACAGCACCAAGCCATGAGGG + Intergenic
1198153431 X:133933614-133933636 AAGACAGCACCAAGCCATGAGGG - Intronic
1198808540 X:140511339-140511361 TAGACGCCAAAAAGCCATCACGG - Intergenic
1198977910 X:142357993-142358015 AGGACAACATCAAGCCATGAGGG - Intergenic
1199128533 X:144156489-144156511 AAGACAGCACCAAGCCATGCGGG - Intergenic
1199134350 X:144233152-144233174 AAGACAACACCAAGCCACGAGGG - Intergenic
1199329695 X:146544183-146544205 AGGACAGCACCAAGCCATGAGGG + Intergenic
1199393664 X:147309587-147309609 AAGACAGTACCAAGCCATGAAGG + Intergenic
1199421386 X:147648895-147648917 AAGATGACACCAAGCCATGAGGG - Intergenic
1199423764 X:147677052-147677074 AAGATAGCACCAAGCCATGAGGG - Intergenic
1199834283 X:151573181-151573203 AAGACAGCACCAAGCCATGAAGG + Intronic
1199865329 X:151842951-151842973 AGGACAGCACCAAGCCATGAGGG - Intergenic
1200300231 X:154966968-154966990 AAGACAGCATCAAGCCATGAGGG + Intronic
1200766057 Y:7081784-7081806 AACACAGCACCAAGCCATGAGGG + Intronic
1201222306 Y:11783697-11783719 AGGACAACACCAAGCCATAAGGG - Intergenic
1201577116 Y:15472749-15472771 CAGAAAACACCTAGCTATCAGGG - Intergenic