ID: 1190221489

View in Genome Browser
Species Human (GRCh38)
Location X:48515097-48515119
Sequence GGGCAGGAGCAGAGTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1050
Summary {0: 2, 1: 0, 2: 21, 3: 121, 4: 906}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190221479_1190221489 27 Left 1190221479 X:48515047-48515069 CCTGAGGCGGGAACTTGCCTGGT 0: 1
1: 0
2: 2
3: 54
4: 278
Right 1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG 0: 2
1: 0
2: 21
3: 121
4: 906
1190221483_1190221489 10 Left 1190221483 X:48515064-48515086 CCTGGTGTGTGGGGAACAGCAAG 0: 1
1: 0
2: 2
3: 30
4: 219
Right 1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG 0: 2
1: 0
2: 21
3: 121
4: 906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190221489 Original CRISPR GGGCAGGAGCAGAGTGAGCC AGG Intronic
900115177 1:1025199-1025221 GGCCAGGGTCAGAGTGAGTCTGG + Intronic
900281607 1:1873281-1873303 GGGCAGGAGCAGAGTTTGACAGG - Intronic
900307738 1:2019333-2019355 GGGCGGGAGCTGAGCGAGCGCGG - Exonic
900310989 1:2033028-2033050 GGGCAGGAGCAGATGAAGGCGGG + Intergenic
900322935 1:2093938-2093960 GGGCCAGGGCAGAGGGAGCCAGG + Intronic
900341122 1:2189854-2189876 CGGCAGGAGCAGAGAGGGCCCGG - Intronic
900367228 1:2316205-2316227 GCGCAGGGGCAGAGAGAGCTGGG + Intergenic
900382149 1:2390328-2390350 TTGCAGGAGATGAGTGAGCCAGG + Intronic
900418236 1:2544776-2544798 GGCCAGGACAACAGTGAGCCGGG + Intergenic
900564187 1:3324291-3324313 AGAGAGGAGGAGAGTGAGCCCGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900780420 1:4614252-4614274 GAGCAGCAGCAGAGTCAGACTGG + Intergenic
900782870 1:4629214-4629236 GGCCAGCAGAAGAGAGAGCCTGG - Intergenic
901046473 1:6399154-6399176 TGGCTGGAGCTAAGTGAGCCAGG - Intergenic
901629774 1:10642481-10642503 GGGCAGGAGGAGAGAGAGGCGGG + Intronic
901789392 1:11646487-11646509 GAACAGGTGCAGAGTGAGGCAGG - Intergenic
902202176 1:14841908-14841930 AGGCAGGAGCACAGCTAGCCTGG - Intronic
902440403 1:16425657-16425679 GGCCAGGATCAGAGTGAGCTGGG - Intronic
902541523 1:17158969-17158991 GGGAAGCAGCAGAGAGAGCCAGG - Intergenic
902669982 1:17966520-17966542 GGGCAGGAGCCAAGTCAGCAAGG - Intergenic
902836664 1:19051844-19051866 GGGAAGGGGCAGAATGAGCCTGG - Intergenic
903183104 1:21614941-21614963 GGCCAGGAGCAGATAGAGGCAGG + Intronic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
903370518 1:22832198-22832220 GGGCAGGCACAGAGTGACTCAGG - Intronic
903543531 1:24109961-24109983 GGGCCGGATCAGATTGACCCAGG + Intronic
903790535 1:25889926-25889948 GGGCAGGTGCAGTGTGTTCCTGG - Intronic
903820047 1:26095015-26095037 GGGCAGGGGCAGGGCCAGCCTGG + Intergenic
904034067 1:27549806-27549828 AGGCAGGTGCTGAGTGGGCCGGG - Exonic
904038528 1:27571448-27571470 GGGCAGGAGCAGAACAAGTCAGG + Intronic
904648528 1:31986917-31986939 GTGCAGGAACTGTGTGAGCCAGG - Intergenic
904847309 1:33430375-33430397 GGGCACCAGCAGAGGGAACCGGG - Intronic
904997733 1:34644015-34644037 GGGAAGGAGCAGAGAGAGAGAGG + Intergenic
905004079 1:34696309-34696331 TGACTGGAGCAGTGTGAGCCGGG - Intergenic
905105654 1:35562182-35562204 GGACTGGCACAGAGTGAGCCAGG - Intronic
905191703 1:36240387-36240409 GGGCAGGAGGAGAGGAAGCCAGG + Intronic
905270300 1:36783222-36783244 GGGCAAAAGCTGAGTGAGCAAGG + Intergenic
905395561 1:37664216-37664238 TGGCTGGAGCAGGGGGAGCCTGG - Intergenic
905519320 1:38586052-38586074 GGGAAGGAGCAAAGTGAGAAGGG - Intergenic
906109183 1:43312075-43312097 GGGAAGGAGGAGAGGGGGCCTGG + Exonic
906212717 1:44021121-44021143 GGGCTGGAGGAGAGGGACCCAGG - Intronic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
906519393 1:46458318-46458340 GGACAGGTGCAGCCTGAGCCTGG - Intergenic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907347624 1:53795964-53795986 TGGCTGGAGCAGAGTGAGTGAGG - Intronic
907390726 1:54156488-54156510 AGGCAGGAGCAGAGACACCCAGG - Intronic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907534740 1:55140720-55140742 GGGCAGCAGCAGAGTGAGGTAGG + Intronic
907657524 1:56359480-56359502 GAGCAGGAGGAGAGAGAGACAGG - Intergenic
908004841 1:59717382-59717404 GGGCAGTATCAGAGTGGTCCAGG - Intronic
908647053 1:66289545-66289567 TGGCTGGAACAGAGTGAGCTAGG + Intronic
908703951 1:66930458-66930480 GGGGAGGAGTGGAGTGGGCCTGG + Intronic
909046941 1:70721680-70721702 GGGCAAGAGCAGTGTGATCATGG + Intergenic
909381467 1:75003753-75003775 GGGAAGGAGGAGAGTGAGAGAGG - Intergenic
911164028 1:94709285-94709307 CGGCTGCAGCTGAGTGAGCCAGG - Intergenic
912243471 1:107936852-107936874 GGGAAGGAGCAGCGTGACACAGG - Intronic
912459905 1:109823688-109823710 GGGCAGCAGGTGAGTGAGGCTGG + Intergenic
912464723 1:109864001-109864023 TGGCAGCATCAGAGAGAGCCTGG - Intergenic
912625615 1:111203198-111203220 GGGAAGGAGCAGGGTGTGGCAGG + Intronic
912951930 1:114126213-114126235 TGGCAGGAGGAGGTTGAGCCAGG + Intronic
912967834 1:114251713-114251735 GGGTAGGAGCAGAGTGATGAGGG - Intergenic
913314190 1:117536276-117536298 AGGCTGGAGCAGAATGAGCTAGG + Intergenic
913549843 1:119906782-119906804 AGACAGGGGCAGAGTGATCCTGG + Intergenic
913972026 1:143423191-143423213 AGCCAGGAGCAGAGACAGCCCGG + Intergenic
914066407 1:144248804-144248826 AGCCAGGAGCAGAGACAGCCCGG + Intergenic
914112746 1:144717550-144717572 AGCCAGGAGCAGAGACAGCCCGG - Intergenic
914240306 1:145848663-145848685 GGAAAGGTGCAGAATGAGCCAGG + Exonic
914252894 1:145936458-145936480 AGCCGGGAGCAGAGTGTGCCGGG - Exonic
914689895 1:150016546-150016568 GGGCAGGAGAAGTTTGAACCCGG - Intergenic
915349045 1:155213217-155213239 GGGCTGGAGCAGAGAGAGAAGGG - Exonic
915352232 1:155233844-155233866 GGGCTGGAGCAGAGAGAGAAGGG - Intergenic
915989569 1:160500344-160500366 GGGCTGGAGCAAAGTGAACAAGG - Intronic
916798615 1:168192250-168192272 AGGCAGGAGAAGCGTGAACCCGG + Intronic
916990467 1:170238099-170238121 GGGCAGGAGCACAGTGGGCCGGG + Intergenic
917853952 1:179086975-179086997 GGGCAGGGGCAGGCTGAGCTGGG + Intronic
918106741 1:181421983-181422005 GGGCAGGAGCACAGGGAACAAGG - Intronic
918225294 1:182475670-182475692 AATCAGGAGCAGAGTGAGCTTGG - Intronic
918237207 1:182592201-182592223 AGGCTGGAGCAGAGTGAGGGAGG + Intergenic
918346299 1:183610197-183610219 GGGCAGGAGCAGGGTGTGGCTGG + Intergenic
920188779 1:204179215-204179237 GGACAGGCACAGAGTCAGCCTGG - Intergenic
920347795 1:205317708-205317730 AGGCAGGTGCAGAGGGAGCTGGG + Intronic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921217486 1:212950411-212950433 GGACAGGAGTAGGGGGAGCCTGG - Intergenic
921328758 1:214014701-214014723 GGGCAGAGGCAGATCGAGCCAGG + Intronic
921383120 1:214544925-214544947 GGGGAGGAGCAGAGTGAAGGTGG + Intronic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
921861401 1:220046101-220046123 AGGGAGGCGCAGTGTGAGCCCGG - Intronic
922002460 1:221493880-221493902 GAGCAAGAGCAGAGTGAGCAAGG - Intergenic
922467448 1:225853862-225853884 GGGCAGGAGCAGAAAGCCCCTGG + Intronic
924729117 1:246696098-246696120 GCGCGGGTGCAGAGGGAGCCTGG - Intergenic
924800152 1:247323500-247323522 GGGCTGTAACAGAGTGTGCCTGG + Intronic
1062798059 10:358847-358869 GGGGAGGAGCAGAGGAAGCAGGG + Intronic
1063186020 10:3652241-3652263 GAGCAGCATCAGAGTGGGCCTGG + Intergenic
1063223482 10:3992746-3992768 AGGCAGGTGCAGAGGCAGCCTGG + Intergenic
1063951192 10:11224912-11224934 GGCCAGGATCAGAGGGAGTCAGG + Intronic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1065154223 10:22853103-22853125 TGGAAGGAGCTGAGTCAGCCAGG + Intergenic
1065797620 10:29321785-29321807 GGGCTGGGACAGAGTGAGCAGGG - Intergenic
1065814687 10:29473127-29473149 GGGGAGGAGCAGGGGGAGCTTGG + Intronic
1065836229 10:29660725-29660747 GGTCAGGAGGGGAATGAGCCAGG - Intronic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1067084165 10:43229435-43229457 GGGCAGGAGCAGAGGCAGGCTGG + Intronic
1067690361 10:48497802-48497824 GGGATGGAGCAGAGTGAGAGGGG - Intronic
1067796847 10:49327109-49327131 GGGCTGGAGTAGAGTGCGCCTGG - Exonic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069380817 10:67841945-67841967 GGGCAGCAGCACCCTGAGCCTGG - Intergenic
1069521364 10:69124194-69124216 GCGCCGGAGCGGAGGGAGCCGGG + Exonic
1069594367 10:69661111-69661133 TGGCAGGGGCAGAGAGAGTCGGG + Intergenic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1069920144 10:71811482-71811504 GAGCAGGACCAGGGTAAGCCCGG - Intronic
1070789544 10:79181161-79181183 GGGCAGGAGCAGGGAGCACCCGG + Intronic
1070873964 10:79783946-79783968 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071396146 10:85225958-85225980 AAGCAGGAGCAGAGAGAGCATGG + Intergenic
1071556050 10:86602298-86602320 GGGCAGGAGGGGAGTGAGGCTGG - Intergenic
1071640896 10:87306085-87306107 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071654340 10:87431851-87431873 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1072279509 10:93853041-93853063 GGGCAGGAGGCCAGTGAGTCAGG - Intergenic
1072307319 10:94120166-94120188 GGGCAGGAGGACATGGAGCCTGG - Intronic
1072422778 10:95303499-95303521 GGGCAGGAGCTGAGGGAGTGAGG + Intergenic
1072574188 10:96685362-96685384 TGGGAGGAGCAGAGGCAGCCAGG + Intronic
1073057193 10:100710310-100710332 GGGCAGGAGTGGAGGGAGGCGGG - Intergenic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1073478248 10:103768449-103768471 TGGCTGGAGTGGAGTGAGCCAGG + Intronic
1074756636 10:116628470-116628492 GGGAAGGAGAAAAGTGAGGCCGG + Intronic
1075096606 10:119475507-119475529 GGGCAGGAGGAAAGTGAGCGTGG - Intergenic
1075402408 10:122170755-122170777 GGGGAGGAGCGGCGGGAGCCAGG - Intronic
1076342534 10:129759594-129759616 GAGCAGGAGAGGAGGGAGCCTGG + Intronic
1076452298 10:130565126-130565148 GGTGAGGAGGAGAGTGTGCCTGG - Intergenic
1076521705 10:131085281-131085303 GGGCAGGTGCACAGTGCTCCAGG - Intergenic
1076594623 10:131617911-131617933 GTGCAGGAACACAGGGAGCCTGG + Intergenic
1076723687 10:132403841-132403863 GGGCAGGACCTGAGGGTGCCAGG + Intronic
1076814086 10:132906127-132906149 GGGCCGGAGCAGAGTTGGTCTGG - Intronic
1076821702 10:132942841-132942863 GGGAAGGTGGAGGGTGAGCCCGG - Intergenic
1076883915 10:133252595-133252617 GGTCAGGAGCAGAGTGGGACAGG - Intergenic
1077125537 11:933977-933999 TGGCAGGAGCACAGGGTGCCAGG + Intronic
1077145051 11:1040942-1040964 GGGGAGGGGCAGCGTGACCCCGG + Intergenic
1077195784 11:1279308-1279330 AGGAAGGAGGGGAGTGAGCCAGG - Intronic
1077278241 11:1728038-1728060 GGTCAGGGGCAGGATGAGCCAGG - Intergenic
1077307830 11:1875843-1875865 AGCCAGGAGCAGAGACAGCCCGG - Intronic
1077317962 11:1927662-1927684 GGGCAGGAGCAGAGGAGGCAGGG + Intronic
1077366688 11:2164098-2164120 GTGCAGGGGCAGTGGGAGCCTGG + Exonic
1077478715 11:2803101-2803123 GGTGAGGGGCAGAGTGAGCAAGG + Intronic
1078359285 11:10655962-10655984 GGGCAGGAGCAGCGTGGGAATGG - Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078457051 11:11483563-11483585 GGCCAGGAGCAGGCTGGGCCAGG - Intronic
1080165784 11:29234553-29234575 TGGCAAGAGCAGAGTGAGAGAGG - Intergenic
1080305242 11:30828131-30828153 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1080411724 11:32031260-32031282 GGGCATGAGCGGAGGGAGCGTGG - Intronic
1080699530 11:34632684-34632706 GGGCAAGAGCAGAGAGAGCCGGG - Intronic
1080791521 11:35525939-35525961 GGGCGGGAGCAGAGGTACCCAGG + Intronic
1081605438 11:44524620-44524642 GAGCAGGCCCAGAGGGAGCCGGG - Intergenic
1081654428 11:44848218-44848240 GGGCAGGGGCAAGGTCAGCCAGG - Intronic
1081691671 11:45082538-45082560 GAGCAAGATCAGAGTGGGCCAGG + Intergenic
1082005389 11:47416151-47416173 GAGCAGGCACATAGTGAGCCCGG + Exonic
1082986161 11:59172585-59172607 GGCCAGGAGCATGGCGAGCCCGG - Exonic
1083176351 11:60952267-60952289 GGGCAGGAGCCCTGTGACCCAGG - Intronic
1083187389 11:61025774-61025796 GGGCAGGGGCAGTGGCAGCCAGG - Intergenic
1083190698 11:61050026-61050048 GAGCTGGAGCAGAGGGAGCCAGG - Intergenic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083590222 11:63889329-63889351 GGCCAGAAGCAGAGTAAGCCAGG - Intronic
1083630619 11:64093394-64093416 GGGCAAGGGCTGAGTGAGCCGGG + Intronic
1083668031 11:64285843-64285865 GGGGCGGAGCAGCGGGAGCCGGG + Intronic
1083750131 11:64756228-64756250 TGGCAGCACCAGAGGGAGCCAGG + Intronic
1083761944 11:64823610-64823632 GGGAAGGGCCAGAGTGTGCCCGG + Exonic
1083855904 11:65392986-65393008 TGGCAGGAGCAGAGTGGGAGAGG + Intronic
1084218859 11:67665875-67665897 GGCCAGGAGAAGGGTGAGGCGGG - Intronic
1084288590 11:68147350-68147372 GAGCAGGAGCAGGGGTAGCCCGG - Intergenic
1084411633 11:69009342-69009364 GGGCAGGAGGAGGGTCAGCCTGG + Intronic
1084753932 11:71222748-71222770 GAGCAGGAGCAGACTGAGAGAGG - Intronic
1084943310 11:72625801-72625823 GGGCAGGAGGAGAGGGAGCTTGG - Intronic
1085034779 11:73293293-73293315 GGGCAAGGGCAGAGTGGCCCTGG + Intronic
1085409760 11:76284132-76284154 GGGCAGGTGCTGAGTGTGCTTGG + Intergenic
1086794199 11:91080470-91080492 GGGCAGCTGCAGAGTGATGCTGG + Intergenic
1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG + Intergenic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088432041 11:109769220-109769242 GTGCAGAAGCAGAGTGATACAGG + Intergenic
1088689265 11:112311411-112311433 GTGAGGGAGCAGAATGAGCCAGG + Intergenic
1088847389 11:113679999-113680021 GGCCAAGACCAGAGTGAGGCAGG + Intergenic
1089348857 11:117809772-117809794 GGGGAGGAGCAGAGCAACCCAGG - Intronic
1089539067 11:119179042-119179064 GGGCAGGAGCATAGCGAGTGGGG + Intronic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1089757232 11:120695875-120695897 GGACAAGACCAGAGTGGGCCTGG + Intronic
1090014820 11:123076653-123076675 GGTCTGGAGCATAGTGAGCAAGG + Intronic
1090350270 11:126103651-126103673 GTGCAGGTGCAGAGTGCGTCTGG - Intergenic
1090570788 11:128042572-128042594 GGGGTAGAGCAGAATGAGCCAGG + Intergenic
1091108315 11:132943188-132943210 GGGAAGGGGCAGAGTTCGCCAGG + Exonic
1091284679 11:134402034-134402056 AAGCAGGAACAGAGGGAGCCAGG - Intronic
1091551590 12:1539175-1539197 GGGAGGGAGCAGAGTCACCCTGG + Intronic
1092090557 12:5800240-5800262 TGGCTGGGGCAGAGTGAGCACGG + Intronic
1092155113 12:6277124-6277146 TGGCAGGAGCAGAGCAAGCAAGG + Intergenic
1092180457 12:6443264-6443286 GAGCAGGAGCAGGGTCTGCCTGG - Intergenic
1092531410 12:9348674-9348696 GTGAAGGAGCAGAGAGAGTCAGG - Intergenic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1092943878 12:13435613-13435635 GGGGAGGGGCAGAGAGAGTCTGG - Intergenic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1094192757 12:27713545-27713567 GGGCAGGGGAAGAGTGTCCCAGG + Intronic
1095225780 12:39675087-39675109 GGGCATGATGAGAGTGAGACAGG + Intronic
1095789684 12:46151059-46151081 GGGCAGCAGGAGAGAGAGCAGGG - Intergenic
1095952679 12:47790248-47790270 GGGCCTGAGCAGAGTCAGCTGGG - Intronic
1096059241 12:48682420-48682442 CGCCCGGAGGAGAGTGAGCCGGG + Intergenic
1096105444 12:48994897-48994919 GGGCAAGGGCTGAGTCAGCCGGG - Intergenic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096309251 12:50505476-50505498 GCGCAGAAGCAGTGTGGGCCCGG - Intronic
1096678945 12:53242142-53242164 GAGCAGGTGCAGGGTGGGCCCGG - Intergenic
1096695583 12:53346077-53346099 GGGGAGGAGGAGAGGGAGCCAGG + Intergenic
1096752727 12:53772380-53772402 GGGCAGGAGCAATGTGAATCAGG - Intergenic
1096994635 12:55830947-55830969 AGGCAGCAACAGAGTGACCCTGG + Intergenic
1097503737 12:60438578-60438600 GATCGGGGGCAGAGTGAGCCAGG + Intergenic
1097561951 12:61218611-61218633 AGGCAGGAGAAGAGTGGGACAGG - Intergenic
1097891354 12:64780767-64780789 CGGGAGGAGCAGCGGGAGCCGGG + Intergenic
1097949795 12:65415066-65415088 GATCAGGATCAGAGTCAGCCTGG + Intronic
1098445739 12:70564019-70564041 TGGCTGGAACAGAGTGAGCGAGG - Intronic
1098521621 12:71440091-71440113 GGACAGGAGCACACCGAGCCGGG - Exonic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1100204248 12:92331011-92331033 GGGCAGGAGGAGAGGAAGCAAGG - Intergenic
1101563156 12:105879435-105879457 TGGCTGGGGCAGAGTGACCCAGG + Intergenic
1101699223 12:107155984-107156006 TGGCTGGGGTAGAGTGAGCCAGG + Intergenic
1102500510 12:113349013-113349035 GGTCAGGAACAGAGGGAGCAAGG - Intronic
1102532111 12:113554183-113554205 GGGCAGGAGGAGAGAGAGGTTGG + Intergenic
1102597656 12:114005296-114005318 GGGCAGCACCAGAGTTGGCCAGG + Intergenic
1103162399 12:118740327-118740349 TGTCAAGAGCAGAGAGAGCCTGG + Intergenic
1103229929 12:119320835-119320857 AGTCAGGAGAAAAGTGAGCCTGG + Intergenic
1103549106 12:121723569-121723591 GGGCGGGAGAAGAGAGAGGCTGG - Intronic
1103727376 12:123004844-123004866 AGGCGGGAGATGAGTGAGCCAGG + Intronic
1103886790 12:124208446-124208468 GGGGAGGAGGAGAGGGAGCCAGG - Intronic
1103936924 12:124481868-124481890 AGGCAGGAGCAGGGAGACCCAGG + Intronic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104169007 12:126261639-126261661 CCGCTGGAGCAGAGTGAGCCAGG + Intergenic
1104215042 12:126726619-126726641 GCGCAGGAGGAGAGAGAGCGCGG - Intergenic
1104385790 12:128350583-128350605 TGGCTGGAGCAGAGTGAGTGTGG + Intronic
1104417480 12:128607249-128607271 GGGCTGGAGGAGAATGAGCAAGG + Intronic
1104479743 12:129097083-129097105 GGGCAGGGGCAGAGAAACCCTGG - Intronic
1104754471 12:131260452-131260474 TGGCAGGAGGAGAATGAGTCTGG + Intergenic
1104921836 12:132294638-132294660 GGGCAGGAGCAAGGAGAGGCTGG + Intronic
1104976898 12:132556219-132556241 GGGCAGCATCAGGGGGAGCCCGG - Intronic
1105432045 13:20345322-20345344 GGCCAGGAGGAGAGTGGTCCAGG + Intergenic
1105665583 13:22552344-22552366 TGGCTGGAGCAGAGTGGGACAGG + Intergenic
1105706298 13:22969534-22969556 TGGCAGCAGCTGCGTGAGCCAGG - Intergenic
1105934657 13:25088057-25088079 AGGCAGGAGCTGACTGAGGCTGG - Intergenic
1107131394 13:36900094-36900116 TGGCAGGAGTAGAGAGAGCAAGG - Intronic
1107285135 13:38781966-38781988 GGGCAAAAGCAGAGTGGGCCAGG - Intronic
1107707640 13:43123159-43123181 GGGCTGGAGCAGAGTGGGAGAGG - Intergenic
1107966605 13:45603505-45603527 GGGCAGGAGCCAAGGGAGGCAGG - Intronic
1108004628 13:45934431-45934453 GGGCAGGTGCAAAGAGAGGCTGG + Intergenic
1109181765 13:59222454-59222476 GGTCAGGAGCAAAGTCAGCAAGG + Intergenic
1110469441 13:75842265-75842287 GGGCTGGAACAGAGTGAGTAAGG - Intronic
1111996358 13:95169478-95169500 AGGGAGGAGCAGAGCAAGCCAGG - Intronic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1112373941 13:98821260-98821282 GGGCAGGAGGAGAGTGAGGTGGG + Intronic
1112494289 13:99893449-99893471 TGGCAGGGGCAGAGTGAGAGAGG - Exonic
1112725823 13:102303070-102303092 TGGGTGGAGCAGAGTGAGTCGGG - Intronic
1112783322 13:102925833-102925855 GGGCTGGAGCAGGGTGGGCAAGG + Intergenic
1112898935 13:104335970-104335992 GAGCAAGAGCAAAGTGAGCCTGG - Intergenic
1113444435 13:110354888-110354910 CGGCAGTGGCAGAGTGGGCCTGG + Intronic
1114487500 14:23071631-23071653 GGGAGGGAGCTGAGTGAGCAAGG + Intronic
1114654866 14:24310073-24310095 GGGAAGGAGCAGGGTGAGGGAGG + Intronic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1116903605 14:50384436-50384458 GGGCTGGGGCAGGATGAGCCTGG + Intronic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1117400093 14:55351267-55351289 CGGCAGGGCCAGCGTGAGCCTGG + Exonic
1118225773 14:63897783-63897805 GAGCAGGAGCAGGGGGAGCATGG - Intronic
1118592963 14:67414553-67414575 GGGGAGGAGCTGAGAGGGCCAGG - Intergenic
1118604082 14:67490391-67490413 GGGCAGGAACAGACTGTTCCAGG + Intronic
1119074390 14:71621384-71621406 TGGCAGGAAAAGACTGAGCCAGG - Intronic
1119485047 14:74981532-74981554 GAGCAGGCGCAGAGGCAGCCAGG - Intergenic
1119511558 14:75215545-75215567 GGGCAGGGGCAGGGTGGGCAGGG + Intergenic
1119696550 14:76718026-76718048 GGCAGGGAGCAGAGTGAGGCTGG - Intergenic
1120247690 14:82026034-82026056 TGGCAGGAGCTGAGGGAGCTAGG + Intergenic
1120349946 14:83342566-83342588 GGGTATGGGCAGAGTGGGCCTGG + Intergenic
1121398287 14:93647636-93647658 GGGAAGAGGCAGTGTGAGCCAGG + Intronic
1121526065 14:94620392-94620414 GTGCAGGAGCAGAGAGAGTGAGG + Intronic
1121670856 14:95709789-95709811 GGGCAGGACCAGATGGAGGCAGG + Intergenic
1121728636 14:96171122-96171144 GAGCCGGGTCAGAGTGAGCCTGG - Intergenic
1121813605 14:96912678-96912700 GGGCTGGGGCAGAGTGAACAGGG + Intronic
1122053929 14:99079467-99079489 GGGAAGGGCCAGTGTGAGCCTGG - Intergenic
1122357836 14:101134637-101134659 GTGCAGGAGCACAGTGAGGTGGG + Intergenic
1122477385 14:102020177-102020199 TGGAAGGAGCAGAGTCAGCCAGG + Intronic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122519300 14:102332199-102332221 GTGGAGAAGCACAGTGAGCCGGG - Intronic
1122575081 14:102737055-102737077 GTGTAGGAGCTGAGTGACCCTGG - Intergenic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1122771972 14:104101597-104101619 GGGCCCCAGCAGAGTGGGCCGGG - Intronic
1122796848 14:104210319-104210341 GGGCGCGAGCAGACAGAGCCGGG - Intergenic
1122822230 14:104353394-104353416 GGGCAGGAGGGGAGTGAGGATGG + Intergenic
1122825760 14:104369679-104369701 GGGAAGGAGCTGAGGGAGACTGG - Intergenic
1122871535 14:104641080-104641102 GGTCAGGAGCAGAGGGTGCTGGG + Intergenic
1123062161 14:105599297-105599319 GGGCAGTAGGAGAGGGGGCCTGG + Intergenic
1123086906 14:105721025-105721047 GGGCAGTAGGAGAGGGGGCCTGG + Intergenic
1123176184 14:106421557-106421579 GAGCAGGTGCAGGGTGAGCGGGG - Intergenic
1202832684 14_GL000009v2_random:53883-53905 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
1202947500 14_KI270726v1_random:42008-42030 GAGCAGGTGCAGGGTGAGCGGGG + Intergenic
1123711335 15:22989965-22989987 GGGCAGGAGGTGAGAGATCCAGG - Intronic
1123945712 15:25237901-25237923 GTGCAGGAGCTGAGGGTGCCAGG - Intergenic
1124133250 15:27009105-27009127 GGGCAGCTGAAGAGTGAGCTGGG - Intronic
1124614315 15:31230553-31230575 GGGCACGAGGTGGGTGAGCCCGG + Intergenic
1124781135 15:32635156-32635178 AGACTGGAGCAGAGTGAGCAAGG - Intronic
1125769348 15:42154538-42154560 GGGAAGGAGCAGAGTGGGGAGGG + Intronic
1125899240 15:43329929-43329951 GGCCAGGAGCAGAGTGGGTGAGG + Exonic
1126787010 15:52185538-52185560 GGGTAGGGGCAGGGTGAGGCTGG + Intronic
1127682271 15:61309485-61309507 GGGCTGGATCAGACTGAGGCAGG + Intergenic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128072786 15:64807852-64807874 GGGAAGGTGCAGAGTGAGGATGG - Intergenic
1128523068 15:68388220-68388242 TGGCTGGAGTAGAGTGAGCTAGG - Intronic
1128635086 15:69298109-69298131 GAGCAGGAGCTCAGAGAGCCTGG + Intergenic
1128674686 15:69599997-69600019 GGACAGGAACAGAGTGAGACAGG - Intergenic
1128682601 15:69662599-69662621 GGGCAGGAGCAGAGAGGGGCTGG + Intergenic
1128802691 15:70506908-70506930 GGGTAGGAGGACAGTGAGTCAGG - Intergenic
1129301938 15:74630472-74630494 GGGCAGGAGACGAGTGGGGCGGG + Intronic
1129312415 15:74722006-74722028 GGGCAGTTGCTGAGGGAGCCAGG - Intronic
1129372742 15:75108430-75108452 GAGCAAGAGCTGAGTGACCCTGG - Intronic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1129539478 15:76338943-76338965 GGGCAGGAGCTTGGTCAGCCAGG + Intronic
1129685355 15:77683146-77683168 GGGGAGAAGCAGAGTGAGTGTGG + Intronic
1129739794 15:77984688-77984710 GGGGGGGAGCAGAGGGAGCTGGG + Intronic
1129845984 15:78767951-78767973 GGGGAGGAGCAGAGGGAGCCGGG - Intronic
1129846235 15:78768896-78768918 GGGAAGGAGCAGAGGGAATCGGG - Intronic
1130059133 15:80557184-80557206 AGGAAGGAGCAGAGTGTGCAGGG - Intronic
1130255891 15:82325912-82325934 AGGGAGGAGCAGAGGGAGCTGGG + Intergenic
1130354872 15:83120115-83120137 GGCCAGCCGCAGAGTGAGACAGG - Intronic
1130384805 15:83401750-83401772 GGAGAGGGGCAGAGAGAGCCAGG + Intergenic
1130599069 15:85264074-85264096 GGGGAGGAGCAGAGGGAGCCGGG - Intergenic
1130821761 15:87503323-87503345 AGGCAGCAGCAGAGGGACCCTGG + Intergenic
1131266793 15:90920249-90920271 GAGCAGGATCAGAGTGACTCTGG + Exonic
1131798630 15:96046572-96046594 GGGCCACAGCAGAGTGAGCGAGG + Intergenic
1131861057 15:96653600-96653622 GGTCGGGGGCAGAGGGAGCCAGG + Intergenic
1131866559 15:96717479-96717501 GGGCAGGAGCAGCCTTAGCTTGG - Intergenic
1132032025 15:98446175-98446197 GAGCTGGTGCAGAGTGAACCAGG - Intronic
1132359282 15:101199068-101199090 GGGCAGCAGCAGTGGGAGCAGGG - Intronic
1132508075 16:322468-322490 GTGCAGGAGCTGAGTTAGCATGG + Intronic
1132530950 16:449146-449168 TGTCAGGAGCAGAGTGAGCAGGG - Intronic
1132615490 16:839470-839492 GGGCAGGGCCAGAGTGGGGCCGG - Intergenic
1132660104 16:1057533-1057555 GGGCAGAGGCAGCGAGAGCCGGG - Intergenic
1132729797 16:1355775-1355797 GGGGAGGAGTAGAGTGGCCCCGG + Intronic
1132864661 16:2087436-2087458 GGGCAGGAGCATAGGGAGGTGGG + Intronic
1133234336 16:4380885-4380907 CGGCAGCAGCAGAGGGACCCTGG - Exonic
1133437596 16:5793262-5793284 GGGGAGAAGCAGAGGCAGCCAGG - Intergenic
1133768750 16:8855527-8855549 GGGAAGGAGCTGATTGGGCCAGG - Intronic
1134363820 16:13557831-13557853 TGGCTGGAGAGGAGTGAGCCAGG - Intergenic
1134450759 16:14361924-14361946 GGGCAGGAGCTGGGTCAGCCTGG + Intergenic
1134692724 16:16201499-16201521 TGGCTGGAGGAGAGTGAGCATGG + Intronic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1134979121 16:18593182-18593204 TGGCTGGAGGAGAGTGAGCATGG - Intergenic
1135007455 16:18839325-18839347 GGGCAGGAGGAGGGTGAGGTAGG - Intronic
1135109715 16:19681249-19681271 GGGCAGGAGGAAAGCGAGGCTGG + Intronic
1135195067 16:20387467-20387489 GGTCTGGAGCAGAGTGAGCTGGG + Intronic
1135197647 16:20407993-20408015 TGGCTGGAGCAGACTGAGACAGG + Intergenic
1135522594 16:23188953-23188975 GGGCAGAGGCAGAGTGAGCTGGG + Intronic
1136683691 16:31982144-31982166 GGGCTGGATCAGAGCGATCCGGG + Intergenic
1137576678 16:49604657-49604679 GGACAGGGGCAGAGGGAGCAGGG - Intronic
1137639130 16:50013246-50013268 GGGCTGGAGCCAAGTAAGCCTGG + Intergenic
1138495109 16:57404100-57404122 TGGCTGGGGCAGAGTGAACCAGG + Intergenic
1138528642 16:57622922-57622944 GGGCAGGGACAGGGTGACCCTGG + Intronic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1139264650 16:65627492-65627514 GGTCAGGACCAGAGTGCTCCGGG + Intergenic
1139651044 16:68362156-68362178 TGACAGGAGCTGAGGGAGCCAGG + Intronic
1139829149 16:69782413-69782435 GGGCAGGAGGAGGATGAGGCAGG + Intronic
1141092190 16:81137849-81137871 GGGAAGGAGCAGGGTGGGGCAGG - Intergenic
1141097446 16:81172853-81172875 TGGCAGGAGGAGAGAGAGCTGGG + Intergenic
1141427458 16:83953335-83953357 GTGCAGGAGCCCAGTGAGCCCGG - Intronic
1141658612 16:85429641-85429663 GGGCTGGAGCAGAGCCAGCAAGG - Intergenic
1141832658 16:86518326-86518348 GGGCAGGACCACAGAGAGTCGGG + Intergenic
1141927092 16:87177096-87177118 GAGCAGGACCAGAGTGAGCAGGG - Intronic
1141976083 16:87517529-87517551 GGGCAGGGAGAGAGTGACCCTGG + Intergenic
1142046102 16:87926293-87926315 GGGCAGGGGCATTGGGAGCCTGG - Intronic
1142178868 16:88657624-88657646 GGGCAGGAGCAGGGCGGGCAGGG - Intronic
1142223563 16:88866614-88866636 GGGCAGGAGGAAGGTGGGCCAGG + Exonic
1142303892 16:89274966-89274988 GGAGAGGAGTAGAGTGAGCTGGG + Intronic
1142592081 17:1010680-1010702 GGGCTGGGCCAGACTGAGCCAGG - Intronic
1142644919 17:1305366-1305388 GGCCAGGAGCACAGTGAGGATGG - Intergenic
1142688598 17:1591731-1591753 GGGAGGGGGCAGAGTTAGCCCGG + Intronic
1142747487 17:1967131-1967153 GGGGAGGAGCGGCGGGAGCCTGG - Intronic
1143238971 17:5427772-5427794 GGGCAGAGGCAGAGGGAGGCTGG + Intronic
1143245303 17:5479872-5479894 GGGTAGGAGCAGACAGTGCCAGG - Intronic
1143289792 17:5820129-5820151 GGGCATGGGGAGAGCGAGCCGGG - Intronic
1143775743 17:9197772-9197794 GGGCAGGGGAAGAGGGAGGCTGG - Intronic
1143861117 17:9891437-9891459 GGGCAGGATAAGGGTGAGGCAGG + Exonic
1145279662 17:21458131-21458153 GCACAGGAGCAGAGGGAGACTGG + Intergenic
1146262636 17:31431925-31431947 GGGCAGGACCGGAGAGCGCCTGG - Intronic
1146314605 17:31797189-31797211 GCCCAGGAGCAGAGTGAGTCTGG + Intergenic
1146634520 17:34494256-34494278 GGGCAGAAGGCGAGGGAGCCTGG + Intergenic
1146920752 17:36708994-36709016 GGGGAGGAGGAGAGTGTGACTGG - Intergenic
1147016389 17:37495182-37495204 GGGCAGGGGCAGCCTCAGCCTGG + Intronic
1147144608 17:38477851-38477873 GGGCTGGATCAGAGCGATCCGGG + Exonic
1147217302 17:38908334-38908356 GGGCAGGTGCCTCGTGAGCCTGG + Intronic
1147315376 17:39617851-39617873 GGGCACGTGCCGAGGGAGCCCGG - Intergenic
1147952231 17:44113679-44113701 AGGGAGGGGCAGAGTGAGTCTGG - Intronic
1148033190 17:44637196-44637218 TGGCAGGAGGAGTGTGAGCCTGG + Intergenic
1148053914 17:44782270-44782292 GGGCAGGAGGGGACTGAGCAAGG + Intergenic
1148108063 17:45129967-45129989 TGGCAGGGGCAGAGCGAGGCGGG + Intronic
1148717421 17:49725682-49725704 TGGCTGGAGCAGAGTGTGTCAGG + Intronic
1148856862 17:50583691-50583713 GGGTAGGAGCAGAGAGATCTAGG + Intronic
1150432768 17:65131681-65131703 GGGCAGGAGGAGAGAGAGCCAGG + Intergenic
1150997549 17:70336263-70336285 AGGCAGCATCAGAGTGAGGCAGG - Intergenic
1151188834 17:72383055-72383077 GGCCAGGAGCTGGGCGAGCCGGG - Intergenic
1151378997 17:73711925-73711947 GGGCAGGGGCAGAGGCTGCCTGG + Intergenic
1151401525 17:73858815-73858837 GGGCAGGTGCAGAGTTCGTCTGG + Intergenic
1151482505 17:74378744-74378766 GGGGAGGACCAAAGTGAGCATGG - Intergenic
1151484180 17:74388175-74388197 GGGCAGGAGCAGAAGGAGAGAGG + Intergenic
1151499064 17:74477432-74477454 GGAGAGGAGCAGCGGGAGCCTGG - Exonic
1152005490 17:77677783-77677805 GGGCCGGAGCAGAGAGAGAGAGG - Intergenic
1152063805 17:78098695-78098717 GGGCAGTAGCTGGGTGAGCCTGG + Intronic
1152319589 17:79601036-79601058 GGGCGGGAGCAGCGGGAGCATGG - Intergenic
1152572004 17:81125031-81125053 GGGCAGGGGCAGGGTGAGCAGGG + Intronic
1152702098 17:81824255-81824277 GGGCAGGAGCTGTGTGTGGCAGG + Intronic
1152761369 17:82108849-82108871 GGGCAGGGGCAGCGTGGGGCGGG + Intronic
1153834142 18:8949290-8949312 GCGCAGGTGGAGAGTGAGCCTGG + Intergenic
1153937181 18:9938579-9938601 GAGCAGGAGTAGTTTGAGCCTGG + Intronic
1154009916 18:10565575-10565597 GGGGCGGGGCAGAGGGAGCCAGG - Intergenic
1154138626 18:11802920-11802942 TGTCTGGAGAAGAGTGAGCCAGG + Intronic
1154299999 18:13184557-13184579 GGGGACGAGCAGTGTGGGCCGGG + Intergenic
1154338976 18:13487890-13487912 GGGCAGGAGCACTGAGAGCAAGG + Intronic
1155276460 18:24192654-24192676 GAGATGGGGCAGAGTGAGCCCGG + Intronic
1155365791 18:25047926-25047948 GGTCAGGAGCAGATGGAGCGAGG + Intergenic
1156019544 18:32583953-32583975 GGGGAGGAGCAGAAAGAGACAGG + Intergenic
1156353745 18:36323171-36323193 GAGGAGGAGCAGAGGCAGCCGGG - Intronic
1156448462 18:37253630-37253652 GGCGAGGAGCAGGTTGAGCCGGG + Intronic
1156449912 18:37261089-37261111 GGGCATGAGCAGGGAGAGGCTGG - Intronic
1156622881 18:38873652-38873674 GGGCCCGAGTAGAGTGAGACTGG + Intergenic
1157089955 18:44625596-44625618 GGGCAGCAGCTGGCTGAGCCTGG - Intergenic
1157279789 18:46338874-46338896 AGCGAGGAGCAGGGTGAGCCGGG - Intronic
1157616986 18:48992785-48992807 GAGCAGGAGCAGACTGAGTGTGG - Intergenic
1157685761 18:49641066-49641088 GGGCAGGGCCAGAGTGAAGCTGG + Intergenic
1157834810 18:50890917-50890939 GGGCAGGGCCATATTGAGCCTGG + Intronic
1157901704 18:51524287-51524309 AGGCAGAAGGAGAGTGAGCTAGG + Intergenic
1158543441 18:58376806-58376828 GAGGAGGAGCAGGGAGAGCCAGG - Intronic
1158557160 18:58484970-58484992 GGGTAGGGGCAGAGGGTGCCTGG + Intronic
1160242491 18:77133203-77133225 CTGCAGGAGGAGAGTCAGCCCGG + Intronic
1160492782 18:79351894-79351916 GGGCAAGGGCAGAGTGGGCTTGG - Intronic
1160868966 19:1268416-1268438 GTGGAGGAGCAGAGTGGGCCTGG + Intronic
1160916968 19:1501411-1501433 TGCCAGGTGCAGAGCGAGCCTGG - Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161273395 19:3402857-3402879 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161455615 19:4368354-4368376 GGGCAGGAGAAGCTTGAGCCTGG + Intronic
1161488310 19:4547815-4547837 TGGCTGGAGCACAGTGAGCAAGG - Intronic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161629354 19:5344490-5344512 TGGCGGGAGCAGAGTGAGCGAGG - Intergenic
1161633273 19:5370219-5370241 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161650361 19:5480546-5480568 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161801237 19:6417709-6417731 GGCCAGGGGCAGGGTGGGCCAGG + Intronic
1161962737 19:7531631-7531653 GGGCAGGGTCAGAGGGAGTCGGG - Intronic
1161979658 19:7623957-7623979 GGGCTGGAGCGGAGTGAGGGTGG - Intronic
1162032193 19:7922367-7922389 GGGCAGGAGCAGAGGGATCAAGG + Intronic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1162174932 19:8823553-8823575 AGGCAGGAGCAGGGTGACCAAGG - Intronic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1162447256 19:10731087-10731109 GGGCAGGAGCAGCCCCAGCCAGG + Intronic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162579581 19:11520606-11520628 AGGCAGGAGAATCGTGAGCCCGG - Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162732045 19:12724122-12724144 GGGGAGCAGAAGAGTGAGACTGG + Intergenic
1162797299 19:13093629-13093651 GGGCAGGGGTGGAGTGAACCAGG + Intronic
1162875282 19:13616830-13616852 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1162954007 19:14088583-14088605 GGACAGGAACAGAGAGAGCCGGG + Intronic
1163032933 19:14556149-14556171 TGGCCTGAGCAGAGTGAGTCAGG - Intronic
1163239586 19:16052262-16052284 GCGCACGAGCACAGAGAGCCGGG - Intergenic
1163262876 19:16201819-16201841 AGGCTGGAGCAGAGTGAACCAGG + Intronic
1163323199 19:16586581-16586603 AGGCAGGACCAGGGTGACCCAGG + Intronic
1163427220 19:17246118-17246140 GGGGAGGGGCAGAGGGAGGCGGG - Intronic
1163525799 19:17820762-17820784 GGCCAGAAACAGAGTGAGGCAGG - Intronic
1164482156 19:28620095-28620117 GGGCAGCTGCAGAGGGAGCTAGG + Intergenic
1164590373 19:29503612-29503634 GGGACGGAGCAGAGGGAGCTGGG - Intergenic
1164740247 19:30570393-30570415 TGGCAGGTGCAGAGGCAGCCGGG + Intronic
1165316053 19:35055992-35056014 AGGCCAGAGCAGAGTGAGCCAGG - Intronic
1165323875 19:35102806-35102828 CGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1165357637 19:35313552-35313574 GGGCAGGAGGGGAGTGAGGCAGG + Exonic
1165433051 19:35783223-35783245 GGCCAGCAGCAGAATAAGCCTGG + Intronic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1166051700 19:40264538-40264560 TGGCTGGAGCAGTGTGAGCTAGG - Intronic
1166081247 19:40445068-40445090 GGGCAGGATCGGAGAGAACCAGG - Intergenic
1166316412 19:41992207-41992229 GGCCAGGGCCAGGGTGAGCCAGG - Intronic
1166679536 19:44758401-44758423 GCGCAGCCGCAGGGTGAGCCGGG + Exonic
1166730713 19:45057612-45057634 GGGCAGGAGCAGAGGGTCCTAGG + Intronic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1167161033 19:47767148-47767170 GGGCAGGAACCCAGTGGGCCAGG - Intergenic
1167383951 19:49153359-49153381 GGGAAGGAACCGAGTCAGCCTGG - Intronic
1167688465 19:50970652-50970674 GGGCAGTAGCAGAGGGATCTGGG + Intergenic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1167932194 19:52874932-52874954 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167963187 19:53123600-53123622 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1168311352 19:55462438-55462460 TGGCTGGAGCGGAGTGAGCAGGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168520325 19:57045001-57045023 AGGAAGGGGCAGAGAGAGCCGGG + Intergenic
1168713942 19:58516521-58516543 TGGGAGCAGCAGAGGGAGCCGGG + Exonic
1202639997 1_KI270706v1_random:73848-73870 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
925178164 2:1799309-1799331 GTGCAGGTGCAGAGCGTGCCTGG + Intronic
925417203 2:3678715-3678737 AGGAAGGGGCAGCGTGAGCCCGG + Intronic
925452726 2:3984086-3984108 GGGAAGTACCAGAGCGAGCCTGG + Intergenic
925480833 2:4272340-4272362 GGGTAGGAGGAGAGTGAGAATGG - Intergenic
925842903 2:8009194-8009216 GGGCTGGAGCTGAGTCAGGCCGG + Intergenic
925858151 2:8150322-8150344 GGGCAGGAGCAGGGAGGCCCTGG - Intergenic
925947322 2:8877872-8877894 GGGCTGGAGCAGAGTGGACCCGG + Intronic
926206519 2:10837776-10837798 GGGCATGAGCAGAATAAGCAGGG + Intronic
926335184 2:11857525-11857547 TGGCAGGAGCAGAGTTGGGCAGG + Intergenic
926370701 2:12176043-12176065 TGGCATGAGAAGGGTGAGCCAGG + Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
927333203 2:21890592-21890614 GGGCAGGAGCTCAGTGTACCAGG - Intergenic
927631800 2:24780942-24780964 AGGCTGGAGCAGAGTGACCGAGG + Intergenic
928200220 2:29243165-29243187 GGCCAGGAGTAGGTTGAGCCCGG + Intronic
928472003 2:31584067-31584089 GGGCAGGAGAATAGTGGCCCAGG + Intergenic
928593218 2:32838110-32838132 GGGCAGCAGCAGAACCAGCCTGG + Intergenic
928710273 2:33997409-33997431 GGTCAGCAGGAGGGTGAGCCTGG + Intergenic
928854125 2:35783865-35783887 GGGTATGAACAGAGTGAGTCAGG + Intergenic
928970905 2:37027956-37027978 AGGCAAGATCAAAGTGAGCCTGG + Exonic
929534413 2:42771630-42771652 GGGGAGGAGCTCACTGAGCCAGG - Intronic
929546400 2:42857559-42857581 GGGCAGTAACAGAGTAACCCGGG - Intergenic
929591484 2:43150435-43150457 GAGCAGGAGCAGTGTCTGCCTGG + Intergenic
929766526 2:44848336-44848358 GGGAAAGAGCAGAGTGAGCCTGG + Intergenic
929826588 2:45313668-45313690 AGGCAGGAGCAGAGTAAACAAGG + Intergenic
929836404 2:45404834-45404856 TGGCCAGAGCAGAGTGAGCAAGG - Intronic
930142253 2:47964397-47964419 GGCCAGGAGCAGAGGGAGGGAGG + Intergenic
931146717 2:59527262-59527284 TGGCTTGAGCAGAGTGAGCAGGG - Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
932347889 2:71007472-71007494 GGGCAGGGGCTGGGAGAGCCTGG + Intergenic
932406162 2:71513668-71513690 GGGCAGGGCCAGAGGGATCCAGG + Intronic
932731607 2:74225867-74225889 GAGCATGAGCAGAGTGACCCTGG - Intronic
933331343 2:80896555-80896577 GGGAAGGAAGAGAGTGAGGCAGG - Intergenic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
933943252 2:87262806-87262828 GTGCAGGGGCTGGGTGAGCCTGG + Intergenic
934176725 2:89584128-89584150 AGCCAGGAGCAGAGACAGCCCGG + Intergenic
934287031 2:91658488-91658510 AGCCAGGAGCAGAGACAGCCCGG + Intergenic
934517781 2:94999514-94999536 AGGCAGGCGCAGAATGAGGCAGG + Intergenic
934776271 2:96939561-96939583 GGGAAGGAGGAGAGTATGCCAGG + Intronic
935101213 2:99997859-99997881 GAGCAGGAGAACAGTGAGGCTGG - Intronic
935136679 2:100310280-100310302 GGGCAAAGGTAGAGTGAGCCAGG - Intronic
935363961 2:102270259-102270281 AGGCAGGAGCAGAGAGAGGGAGG - Intergenic
935593031 2:104857860-104857882 GGGAAGGAGCAGAGGGAGAGGGG + Exonic
935717501 2:105952196-105952218 GGTCAGGAGCAGTGGGACCCAGG - Intergenic
935731170 2:106065805-106065827 GAGCAGGAGCAGCGCCAGCCCGG - Exonic
936030948 2:109070157-109070179 GGCCTGGAGCAGAGTGAGTGAGG + Intergenic
936147067 2:109987243-109987265 TGGGAGCAGCAGAGGGAGCCGGG + Intergenic
936197625 2:110384240-110384262 TGGGAGCAGCAGAGGGAGCCGGG - Intergenic
936336962 2:111598755-111598777 GTGCAGGGGCTGGGTGAGCCTGG - Intergenic
936520102 2:113206480-113206502 GGGCAAGATCAGGCTGAGCCTGG - Intronic
937029686 2:118728167-118728189 GGGCAGGAAAAAAATGAGCCTGG + Intergenic
937225296 2:120365384-120365406 GGGCTAGAGAAGAGTGACCCTGG - Intergenic
937419245 2:121740810-121740832 GGGAAGGAGGAGAGGGGGCCTGG - Intronic
937523126 2:122735636-122735658 AGGAAGGAGCCCAGTGAGCCTGG + Intergenic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
938196683 2:129334799-129334821 GGGCATCAGCAAAGTGAGGCTGG + Intergenic
938259129 2:129882772-129882794 GGGCAGGAACAGAGGGAGGGAGG - Intergenic
938696638 2:133840951-133840973 GGTCAGGCGCAGAGGGAGCAAGG + Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939279386 2:140042643-140042665 TGGCAGGAGCAGTGTGAGAGAGG - Intergenic
940761341 2:157742392-157742414 GGGACGGAACAGACTGAGCCAGG + Intronic
942034193 2:171994933-171994955 TGGCAGGAGCTGAGGGAGCGAGG - Intronic
944053309 2:195496011-195496033 TGGCTGGAGCAGAGTGAGTGGGG - Intergenic
944871676 2:203918458-203918480 GGGCGGGAGGAAAGTGAGGCTGG - Intergenic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
946307581 2:218864996-218865018 GGGCAGGGGCAGAAGGAGGCTGG + Intronic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946417518 2:219547821-219547843 GGGCCAGCGCAGAGTGAGCAGGG - Exonic
946427214 2:219605769-219605791 GGGAAGGGGGAGAGTGAGGCTGG + Intronic
946428281 2:219611524-219611546 GGGAAGGAGCATCGTGAGCATGG + Intronic
946855740 2:223948084-223948106 AGGCTGGAGCAGAGTGAGTGAGG + Intergenic
947010534 2:225561380-225561402 TGGCTGGAACAGAGTGAACCTGG + Intronic
947739809 2:232479971-232479993 GGCCTGGAGCAGGGTGAGGCTGG - Exonic
947929528 2:233952354-233952376 AGGCAGGTGCCGAGGGAGCCTGG + Intronic
948230955 2:236349027-236349049 GGGTAGGAGCAGAGTCACGCAGG - Intronic
948383281 2:237566480-237566502 GGGCAGGAGCAGCGTCACACAGG - Intergenic
948536712 2:238652291-238652313 AGGCAGGAGCAGAGGGGCCCCGG - Intergenic
948546117 2:238730111-238730133 GGGCAGGAGCAGTGCTAGCATGG - Intergenic
948783881 2:240340881-240340903 GGGCAGGAGCCGCAGGAGCCAGG + Intergenic
948795331 2:240399611-240399633 GGGCAGGACCAGCCTGGGCCTGG - Intergenic
1168957232 20:1842784-1842806 GGGCTGGAGCAAAGTGAGCGAGG - Intergenic
1169005181 20:2200867-2200889 GGGCTGGAGCACAGGGAACCTGG - Intergenic
1169227532 20:3865767-3865789 GGGTCGGAGCTGAGTAAGCCTGG + Exonic
1169318495 20:4612090-4612112 GAGCAGGAGGAGAGTGATGCTGG + Intergenic
1170175200 20:13461038-13461060 TGGCTGGAGCAGTGTGAGCAAGG - Intronic
1170327748 20:15175870-15175892 GGGCAGGAGCCCAGTGTTCCTGG + Intronic
1170606155 20:17876344-17876366 AGGCGGGCTCAGAGTGAGCCAGG - Intergenic
1170798423 20:19570188-19570210 GGCCAGGAGGAGAGAGAGCAGGG + Intronic
1171310966 20:24144263-24144285 GGGCAGGAACAGACTGCACCTGG - Intergenic
1171886888 20:30660498-30660520 GGGGAGGAACAGAGTGGGCCAGG - Intergenic
1172005890 20:31819069-31819091 GGACAGGATCAGAGGGGGCCTGG - Intergenic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172845489 20:37927719-37927741 GGGCAGGAGGAGACTGAGTGGGG + Intronic
1173060023 20:39651817-39651839 AGCCAGAAGCAGAGTCAGCCAGG + Intergenic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173539422 20:43840494-43840516 GGGCTGGAGCAGAGTGATCAAGG + Intergenic
1173598668 20:44277362-44277384 GTGCAGGAGAAGATTGAGGCAGG + Intronic
1174118754 20:48246565-48246587 TGGCTGGAGCATAGTGACCCTGG - Intergenic
1174266685 20:49337024-49337046 GGGCAGGAGCAGAGTGAGTGAGG + Intergenic
1174361117 20:50029540-50029562 GGGTGGGAGCAGAGTGGGCGAGG + Intergenic
1174531999 20:51221722-51221744 TGGCGGGAGCAGAGGGAGCAAGG + Intergenic
1174760203 20:53199791-53199813 GGGCAGGAAGCGTGTGAGCCAGG + Intronic
1174868837 20:54164693-54164715 GGACCGGTGCAGAGAGAGCCGGG - Intronic
1175285055 20:57832302-57832324 GGCCAGGAGCAGCTTGAGCACGG - Intergenic
1175897581 20:62346224-62346246 GGGCAGGAGCCGGGTAAGCCTGG + Intronic
1176085393 20:63293446-63293468 GGGCCGGGGCAGTGGGAGCCCGG + Intronic
1176115882 20:63431826-63431848 GGGCAGGTGCACAGTGTGGCTGG - Intronic
1176195782 20:63835908-63835930 GGGCAGGGGCAGGGAGAGCGCGG + Intergenic
1176195796 20:63835946-63835968 GGGCAGGGGCAGGGAGAGCGCGG + Intergenic
1176195810 20:63835984-63836006 GGGCAGGGGCAGGGAGAGCGCGG + Intergenic
1176195824 20:63836022-63836044 GGGCAGGGGCAGGGAGAGCGTGG + Intergenic
1176195848 20:63836087-63836109 GGGCAGGGGCAGGGAGAGCGCGG + Intergenic
1176195877 20:63836169-63836191 GGGCAGGGGCAGGGAGAGCGCGG + Intergenic
1176195891 20:63836207-63836229 GGGCAGGGGCAGGGAGAGCGTGG + Intergenic
1176195917 20:63836277-63836299 GGGCAGGGGCAGGGAGAGCGCGG + Intergenic
1176195951 20:63836371-63836393 GGGCAGGGGCAGGGAGAGCGAGG + Intergenic
1176195983 20:63836462-63836484 GGGCAGGGGCAGGGAGAGCGCGG + Intergenic
1176207390 20:63896534-63896556 TGGCAGGTGCAGAGTGAGTCAGG - Intronic
1176411504 21:6451702-6451724 GGGAAGCAGCAGAGGGAGTCAGG + Intergenic
1176648330 21:9371440-9371462 GGGGAGGGACAGAGTGAGCCAGG - Intergenic
1176662353 21:9649603-9649625 AGGCAAGAGCAGACAGAGCCAGG - Intergenic
1178038912 21:28617283-28617305 GGGCTGGAGTAGAGGGAGGCAGG + Intergenic
1178601751 21:34000514-34000536 GGCCAGCAGCAGATTGTGCCAGG + Intergenic
1178737056 21:35161801-35161823 GGCCAGGATGAGAGTGACCCAGG - Intronic
1178748217 21:35274223-35274245 GAGCAAGAGCAGAGTGAACAAGG - Intronic
1178815325 21:35924110-35924132 GGGCAGAAGGAGAGTTTGCCAGG + Intronic
1179176196 21:39009993-39010015 GGCCAGGAGGGGAGTGAGCCAGG - Intergenic
1179686998 21:43060024-43060046 GGGAAGCAGCAGAGGGAGTCAGG + Intronic
1179885543 21:44312829-44312851 AGGCAGGAGGAGGCTGAGCCTGG + Intronic
1180030910 21:45206960-45206982 CAGCAGCAGCAGAGAGAGCCTGG + Intronic
1180087890 21:45516218-45516240 GAGCTGGAGGAGGGTGAGCCTGG - Intronic
1180125807 21:45789621-45789643 TGGCCGGAGCAGAGCGAGCAAGG + Intronic
1180198740 21:46212487-46212509 GGACAGGACCAGGGTCAGCCAGG + Intronic
1180873461 22:19161843-19161865 GAGCAGGAGCACAGACAGCCGGG - Intergenic
1180998000 22:19975027-19975049 GGGCAGGAGTAGAGGGAGCATGG - Intronic
1181434257 22:22900994-22901016 GGGCGGGAACAGAGTGACCGAGG - Intergenic
1181436764 22:22915642-22915664 GGGCGGGAACAGAGTGACCAAGG - Intergenic
1181462106 22:23091992-23092014 GGCCAGGAAAAGAGTGTGCCAGG - Intronic
1181694521 22:24586189-24586211 GAGCAGGAGCTGGGTGAGGCGGG + Exonic
1181797338 22:25319785-25319807 CGGCAGGAACAGAGTGACCGAGG - Intergenic
1181875188 22:25935250-25935272 GGTCAGGAGGAGAGTGAGCAAGG + Intronic
1182442539 22:30372687-30372709 GGGCAGGCAGAGGGTGAGCCAGG + Intronic
1182680172 22:32073441-32073463 GGGCAGAAGCAGTGTGAGTCAGG - Intronic
1182797230 22:32999849-32999871 AGGCAGGAGCAAAGTGAAACTGG + Intronic
1183343003 22:37292436-37292458 GGGCAGGAGAGGAGGGAGCAGGG + Intronic
1183356284 22:37361506-37361528 GGGCAGGAGCAGGGTGGGCTTGG - Intergenic
1183378148 22:37476997-37477019 GCCAAGGGGCAGAGTGAGCCTGG + Intronic
1183490185 22:38111790-38111812 GGGCTGGGGCAGAGGCAGCCCGG + Exonic
1183727070 22:39596106-39596128 AGGTCAGAGCAGAGTGAGCCAGG + Intronic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184189118 22:42883193-42883215 TGGCAGGAGCAGGGTGAGGCTGG - Intronic
1184196319 22:42931441-42931463 GGGCAGGTGCAGAGTGGGAGAGG + Intronic
1184373702 22:44098509-44098531 GGGCTGGAGCAGATTGCACCAGG + Intronic
1184825777 22:46949904-46949926 GGGCTGGAGCAGCCTGAGCAGGG + Intronic
1184877061 22:47282696-47282718 AGGGAGGGGAAGAGTGAGCCTGG - Intergenic
1184948604 22:47822742-47822764 AGGCAGGAGCAGACTGAAACTGG + Intergenic
1185000945 22:48245143-48245165 GGGCAGCATCACAGTGAACCAGG + Intergenic
1185011212 22:48315734-48315756 TGGCAGGAGCAGACGGGGCCGGG + Intergenic
1185110245 22:48896503-48896525 TGGCAGGAGCAGAGGGGGTCGGG + Intergenic
1185204809 22:49531756-49531778 GAGGAAGAGCAGAGTGTGCCGGG - Intronic
1185244569 22:49766114-49766136 GGGGAGGAGCCCAGTGGGCCTGG + Intergenic
1185280619 22:49968401-49968423 GGGCTGGAGGAGAGGGAGACAGG - Intergenic
1185287410 22:50008712-50008734 GGGCAGGAGCAGGATGGGCTGGG - Intronic
949503173 3:4701473-4701495 GGACAGGAGCAGAGGCAGCCCGG - Intronic
949537838 3:5009665-5009687 AGGCAGGAGCAGCGTGTGCTGGG + Intergenic
949870335 3:8582730-8582752 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
950505221 3:13390454-13390476 GGGCAGGAGCAGAGCCACGCGGG - Intronic
950563422 3:13749186-13749208 GGCCTGAGGCAGAGTGAGCCAGG - Intergenic
950584936 3:13885566-13885588 GGGCAGGTGCACAGTCAGCCAGG + Intergenic
950627744 3:14260529-14260551 GAGCAGGAGCAGAGAGAGAAGGG + Intergenic
950640128 3:14343433-14343455 GGGTGGGAGCAGGGTGAGGCTGG - Intergenic
950677490 3:14563493-14563515 GAGGAGGAGCAGCGTGGGCCTGG + Intergenic
950704745 3:14772884-14772906 TGGCAGCAGCCAAGTGAGCCAGG + Exonic
952147136 3:30545643-30545665 GGGCAGGAGCAGAGGGTACATGG + Intergenic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
952528457 3:34238716-34238738 GGGCAGAAGCAGAGACAACCAGG + Intergenic
952740640 3:36730938-36730960 GGGCAGGAGCAGGGCGAGTGAGG + Intronic
952881060 3:37986628-37986650 GGGCAGGACCACAGTGGGCAAGG + Intergenic
953119328 3:40024438-40024460 GGGCAGGTGCAGAGAGAGATGGG + Intronic
953480986 3:43251927-43251949 CAGCAGGAGCAGAGAGAGACTGG - Intergenic
953955006 3:47225032-47225054 TGGCTGGAGTAGAGTGAGCAAGG + Intergenic
953979225 3:47405395-47405417 AGGCAGGAGGAGAGTGTGGCTGG + Intronic
954295882 3:49674298-49674320 GGGCAGGGGCGGAGACAGCCCGG + Exonic
954373865 3:50184190-50184212 AGGAAGGAGGAGAGTGAGCCTGG + Intronic
954691442 3:52397655-52397677 GGGCTGGGGCAGAGCAAGCCAGG + Intronic
954710924 3:52504704-52504726 GGCGGGGAGCAAAGTGAGCCGGG - Intronic
954873673 3:53786718-53786740 GGGCAGGGGCAGAGTGGGGCGGG - Intronic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955241920 3:57185932-57185954 GGGCAGGAGAAGAAGGAGCAAGG - Intergenic
955407337 3:58633732-58633754 GGACAGGAACAGAGGGAGCTAGG - Intergenic
955520484 3:59770867-59770889 GGGCAGAAGCAGAGTGGCACAGG - Intronic
955829595 3:62986927-62986949 GGGCTGGGGCAGAGTGGGCTAGG - Intergenic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
957199841 3:77119102-77119124 TGGCAGGAGAAGAGAGAGCAAGG - Intronic
958055040 3:88399421-88399443 ATGCAGGAGCAGAGTGAGTGAGG - Intergenic
958438206 3:94123671-94123693 TGGCTGGAGCAAGGTGAGCCAGG - Intronic
959709980 3:109376385-109376407 AGGCAGGAGAAGTGTGAACCCGG - Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
960992030 3:123318155-123318177 GGGCTGGAGCAGACCGGGCCAGG - Intronic
961043348 3:123692833-123692855 GAGACGGAGCAGAGTGAGCCTGG + Exonic
961047544 3:123719974-123719996 GGATTGGAGCAGGGTGAGCCTGG - Intronic
961270415 3:125683659-125683681 GGATTGGAGCAGGGTGAGCCTGG + Intergenic
961322214 3:126083966-126083988 GCGCGGGAGGCGAGTGAGCCGGG - Intronic
961505542 3:127368633-127368655 GGGCAGGGGGAGAGTGAGGTTGG - Intergenic
961506204 3:127372047-127372069 GGGGAGGAGGAGAGGCAGCCTGG - Intergenic
961519218 3:127457013-127457035 GGGGAGGAGCGGAGGGACCCAGG + Intergenic
961531620 3:127543724-127543746 GGGCAGGAGCAGAAGCAGCAAGG + Intergenic
961533478 3:127554808-127554830 GGGCAGGGGCACAGGGAGCAGGG - Intergenic
961782494 3:129328833-129328855 GGGCAGGAGCAGAGCTACACCGG - Intergenic
961817045 3:129556433-129556455 GGGGAGCAGCGGAGTCAGCCGGG + Intronic
961874919 3:130014946-130014968 AGGGAAGAGCAGAGTGAGCAGGG + Intergenic
961947130 3:130703235-130703257 TGGCTGGAGCAAAGTGAGCGAGG - Intronic
961954547 3:130788056-130788078 GGGTAGGAGTAGAGAGAACCTGG - Intergenic
962264041 3:133933216-133933238 GGCCAGGTGCAGAGTCAGTCTGG + Exonic
962345274 3:134614179-134614201 AGGCAGGAGCTGAGAGAGCACGG + Intronic
963079410 3:141377043-141377065 GGGCAGGAACAGAGTTTGCCTGG - Intronic
963167467 3:142220229-142220251 AGGCAGGAGAAGTGTGAACCCGG - Intronic
963729424 3:148957109-148957131 GGGCAGGAGCAAAGGCATCCAGG - Intergenic
964122167 3:153196303-153196325 AGGCAGTCGGAGAGTGAGCCAGG + Intergenic
964931318 3:162028071-162028093 GTGCTTGAGCACAGTGAGCCAGG + Intergenic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
965553543 3:169996528-169996550 GGGCAAGAGCAGAGTGGAGCTGG - Exonic
966323927 3:178733304-178733326 TGGCTGGAGTAGAGTGAGCTGGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
966642968 3:182210761-182210783 GGGCAGGAGGAGAGTGAGATGGG + Intergenic
966831719 3:184016139-184016161 GCACAGGAGCAGAGAGAGGCAGG + Intronic
967135880 3:186512237-186512259 ATGCAGGCGCAGAGTGAGACAGG + Intergenic
967363991 3:188664926-188664948 TGGCAGGACCTGAGTGTGCCAGG + Intronic
967397910 3:189027266-189027288 TGGCAGGGTCAGAGTGAGGCAGG - Intronic
968102198 3:195974526-195974548 GGCCAGGATCAGATTGTGCCCGG - Intergenic
968230774 3:197003408-197003430 GGGCAGCAGCAGCGGGAGCAGGG + Exonic
1202738554 3_GL000221v1_random:33544-33566 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
968479961 4:828904-828926 GGGCAGGAGCTGAGTGAGAAAGG + Intergenic
968522496 4:1040247-1040269 TGGCAGGAGGCGAGGGAGCCCGG + Intergenic
968542001 4:1172545-1172567 CGGCAGGAGCAGCGGGAGCGCGG + Exonic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968762234 4:2448720-2448742 GGGCTGGAGTGGAGTGAGGCAGG + Intronic
969675081 4:8610124-8610146 GGGCAGGAGCTGGGTGGGCTGGG + Intronic
970213769 4:13737637-13737659 TGGCAGGAGCAAAGTGAGAGAGG + Intergenic
970518329 4:16857582-16857604 TGCTCGGAGCAGAGTGAGCCAGG - Intronic
971418303 4:26453473-26453495 GGGCAGGAGCAGGGGCAGCAGGG + Intergenic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
972572736 4:40325857-40325879 GGCCAGGACCAGAGTGAGGCAGG + Intergenic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973370244 4:49240191-49240213 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
973390785 4:49555229-49555251 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
973938623 4:55879434-55879456 TGGTAGGAGCACTGTGAGCCAGG + Intronic
974240342 4:59238221-59238243 TGGCAGGCACAGAGTTAGCCAGG - Intergenic
975475781 4:74821751-74821773 TGGCAGGAGCACAGTGAGTAAGG + Intergenic
975578870 4:75889321-75889343 TGGCTGGAGAAGAGGGAGCCAGG - Intronic
976053150 4:81031538-81031560 GCGCAGGAGCCGAGGGCGCCAGG - Exonic
976074719 4:81284741-81284763 CGGCTGGAGCAGAGGGAGCTGGG - Intergenic
976119352 4:81762674-81762696 AGGCAGCTGCAGAGTCAGCCAGG - Intronic
976186773 4:82449842-82449864 GGGCTGGGCCAGAGTGAGCTGGG - Intronic
980925496 4:139133015-139133037 AGGCAGGAGTGGAGTGAACCCGG - Intronic
981625177 4:146747248-146747270 GAGCAGTAGCAGTGTGACCCAGG - Intronic
981756739 4:148148129-148148151 GGGCAGGGGAAGGGAGAGCCTGG - Intronic
983377315 4:166946403-166946425 GCGCAGGAGCAGGCTGAGCCTGG - Intronic
984241548 4:177225874-177225896 GGGCAGAATGAGAGTGAGACAGG - Intergenic
985084351 4:186297588-186297610 GTGAAGGAGCTGAGTGAGCAGGG - Intergenic
985413040 4:189706923-189706945 AGGCAAGAGCAGACAGAGCCAGG + Intergenic
1202767357 4_GL000008v2_random:159707-159729 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
985499914 5:236446-236468 GGCCAGGATCAGATTGTGCCCGG + Exonic
985651274 5:1108891-1108913 GGCCAGGGGCAGAGGGAGGCAGG + Intronic
985737474 5:1593244-1593266 GGCCAGGATCAGATTGTGCCCGG - Intergenic
985764459 5:1769452-1769474 GGGCAGGAGCAGAGGCCTCCCGG + Intergenic
985879639 5:2628570-2628592 GAGCAGGAGCTGAGTGGGCAGGG - Intergenic
986253658 5:6083617-6083639 TGGCAGGAGCTGAGTGAGCCAGG - Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
986792229 5:11173232-11173254 GGGCAGGAGGAGAGAGAGCTGGG + Intronic
987962152 5:24824206-24824228 GGCATGGAGCAGAGAGAGCCTGG + Intergenic
988627099 5:32889004-32889026 AGGCTGGAGCAGAGTGGGCAAGG - Intergenic
988657056 5:33223785-33223807 GGTCAGAAGCAAAGTGAGTCCGG - Intergenic
988663826 5:33302978-33303000 TGACAGGAGGAGAGTGAGCATGG + Intergenic
988901854 5:35741451-35741473 TGTCTGGAGCAGAGTGAGCTAGG + Intronic
989605690 5:43242387-43242409 GAGCAGGTGCAGAGAGAGGCAGG + Intronic
990382828 5:55233072-55233094 CGGCAGGAGAGGAGAGAGCCTGG + Intronic
992763159 5:79969712-79969734 GGTCAGGAGCAGAGTGAGCAGGG - Intergenic
994061771 5:95486519-95486541 AGGCAGGGGCAGAGTGATGCCGG - Intronic
994349439 5:98727521-98727543 AGGCAGCAGCAGAGTGATCCAGG - Intergenic
995059283 5:107796146-107796168 GGGCATGAGCAGAGTGAGCAGGG + Intergenic
995524446 5:113039342-113039364 GGTAAGGATCTGAGTGAGCCAGG - Intronic
996139418 5:119887747-119887769 AGGCTGGAGCAGAGTAAGCAAGG - Intergenic
996457726 5:123703942-123703964 GGGGAGGAGGAGAGTAGGCCGGG + Intergenic
996789277 5:127275320-127275342 GGGCTGAAGGAGAGTGAGTCAGG + Intergenic
997211504 5:132079678-132079700 GGGCAGGTGCTGACTGAGGCTGG - Intergenic
997407984 5:133667536-133667558 GAGCTGGAGCTGAGTGAGTCAGG - Intergenic
997459636 5:134043120-134043142 TGGCAGGAGAAGAGTGATCAAGG + Intergenic
997504720 5:134408165-134408187 GGGCAGGGGCAGAGGTAGGCAGG - Intronic
997691705 5:135831842-135831864 GGACAGGGGCAGAGGGACCCAGG + Intergenic
997702227 5:135910872-135910894 AGGCAGGAGAAGAATGAACCAGG + Intergenic
997807547 5:136934127-136934149 GGGCAGGAGGAGAGAAAGCCCGG - Intergenic
998522967 5:142817281-142817303 GAGCAGGAGCAGAGTTGGCAAGG + Intronic
998551052 5:143078353-143078375 GGGCAGGACTAGAGTTAGACAGG - Intronic
998835224 5:146196795-146196817 GGGCTGGAGCAGAATGAACCAGG - Intergenic
998910939 5:146959592-146959614 GGGCAGGAGCTAAGTCAGCTGGG + Intronic
999721519 5:154402241-154402263 GGGCAGGAGCAGAGGGAGAAAGG - Intronic
999857721 5:155613445-155613467 TGGATGGAGCAGAGTGAGCCAGG + Intergenic
1000158376 5:158574631-158574653 AGGCTGGAACAGAGTGAGCAAGG + Intergenic
1000211628 5:159111898-159111920 GGCCAGGATGAGAGTGAACCAGG - Intergenic
1001483076 5:172101908-172101930 AGGCTGGAGAAGAGTGAGGCTGG + Intronic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1002044819 5:176536080-176536102 GGGCATGAGCAGACTCAGCCAGG + Intronic
1002320775 5:178374384-178374406 GGGCAGCAGCAGAGATAGGCAGG - Intronic
1002470546 5:179432771-179432793 GGGCAAGGGCAGGGGGAGCCAGG + Intergenic
1002876650 6:1216350-1216372 GGCCAGGGCCAGAGTGAGGCAGG - Intergenic
1003030824 6:2599090-2599112 GGGCAGGAGCAGTGAGGGGCAGG - Intergenic
1003116416 6:3286649-3286671 GGGCAGGGGCAGGGGGAGGCGGG + Intronic
1003431523 6:6043173-6043195 GGTCAGGATCTGAATGAGCCAGG + Intergenic
1003645910 6:7912629-7912651 GGCCAGGAACACTGTGAGCCAGG - Intronic
1005091506 6:22061692-22061714 GGGCAGGAGCAGATGGAGGAAGG - Intergenic
1005302919 6:24488803-24488825 GGGCAAGGGCAGAGTCATCCTGG - Intronic
1005652017 6:27893471-27893493 GGGCAGGAGCAGATTTAGCCGGG - Exonic
1006190120 6:32202346-32202368 GGGCAGGAGCATCGAAAGCCTGG + Exonic
1006338499 6:33433118-33433140 GTACAGGAGGAGAGTGACCCTGG + Intronic
1006379485 6:33689210-33689232 GGCCAGGGGCAGGGTGAGCAGGG - Intronic
1006390672 6:33756418-33756440 TGGCTGGAGCAGAGGAAGCCAGG + Intergenic
1006830375 6:36964572-36964594 GGGCAGGAGAGGTGTGGGCCCGG - Exonic
1006931273 6:37690083-37690105 TGGCTGGAGCAGAATGAGCCAGG - Intronic
1007029514 6:38615467-38615489 TGGCTGGAGCAGAATGTGCCAGG - Intronic
1007262788 6:40575467-40575489 GGGCAGGCGCAGAGTAAGGCTGG - Intronic
1007424179 6:41736048-41736070 GGGCAAGGCCAGGGTGAGCCTGG + Intronic
1007478862 6:42136915-42136937 GGGGAGGAGCAGAGTGAACAGGG + Intronic
1007486583 6:42184731-42184753 GGGCATGAGCAGGCTGAGCCAGG + Exonic
1007583049 6:42970781-42970803 GGGCAGAATCAGGGTGAGACTGG - Intronic
1007629823 6:43266969-43266991 GTGCAGGATCAGAGAGAGCCTGG + Intronic
1007736336 6:43984622-43984644 AGGCTGGAGCAGAGTGAGCGAGG + Intergenic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1008652598 6:53578144-53578166 AGGCAGAAACAGAGTTAGCCGGG - Intronic
1008920967 6:56843801-56843823 GGGCCGGAGCTGAGCCAGCCGGG - Intronic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1009479621 6:64140574-64140596 GGGAAGGAGCAGAATGAGTTTGG + Intronic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1010022409 6:71175929-71175951 GGGAAGGAGCACTGTAAGCCTGG - Intergenic
1011623695 6:89266404-89266426 GGGCAGGAGCTGGGAGAGCTAGG + Intronic
1011715715 6:90103274-90103296 GTGTGGGAGCAGAGAGAGCCAGG + Intronic
1011842368 6:91517409-91517431 GGCCATGAGCAGAGTGAGGAGGG + Intergenic
1012145571 6:95676590-95676612 GGGCAGTAGAACAGTGTGCCTGG + Intergenic
1012356324 6:98318566-98318588 TGGCTAGAGCTGAGTGAGCCTGG + Intergenic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1012489369 6:99763756-99763778 TGGCTGGAGCATAGTGAGCTAGG + Intergenic
1013175316 6:107671348-107671370 GGGCAGGAGCTGAGGAAGCGAGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1014002939 6:116385150-116385172 TGGCTGGAGCAGAGAGAGACTGG + Intronic
1014222869 6:118815887-118815909 GGTAAGGAGAAGAGTGAGCCAGG - Exonic
1017190506 6:151648490-151648512 GCGCAGGAGCTGGGTGAGGCTGG - Intergenic
1017256574 6:152340262-152340284 AGGCTGGAGCAGAGTGAATCAGG + Intronic
1018002787 6:159594548-159594570 GGGCAGGAGCCCAGGGAGCAGGG + Intergenic
1018333596 6:162760625-162760647 TGGCTGGAGGAAAGTGAGCCAGG + Intronic
1018736122 6:166688378-166688400 GGGGATGAGCAGAGGGGGCCGGG - Intronic
1018905577 6:168073560-168073582 GGGAAGGAGGAGACTGAGACAGG + Intronic
1019283109 7:210436-210458 GGGCAGGAGACAAATGAGCCTGG + Intronic
1019342606 7:515687-515709 GGGCAGGAGGAGAGAGCTCCTGG + Intronic
1019460255 7:1154402-1154424 GGACAGGAGCACAGCGGGCCAGG + Intronic
1019497703 7:1348094-1348116 GGGAAGGAGAAGAGGGAGCCGGG + Intergenic
1019504566 7:1384270-1384292 GGGCAGGGGCGCAGGGAGCCAGG + Intergenic
1019512024 7:1422370-1422392 GGGTTGGGGCAGAGTGAGGCTGG - Intergenic
1019631510 7:2052151-2052173 GAGCAGGAGCAGGGTGACCACGG + Intronic
1020126741 7:5537012-5537034 ATGCAGGAGCAGTGTGATCCAGG - Intronic
1021242398 7:18219860-18219882 AGGCAGGAGCAGAGTGTAGCAGG + Intronic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022019184 7:26382215-26382237 GGGGAGGAGCCGAGAGGGCCAGG - Intergenic
1022026423 7:26452156-26452178 GGGCTGGAGCAGAGCGAGGTTGG - Intergenic
1022793616 7:33714378-33714400 GGGCTGCAGCAGAAAGAGCCTGG - Intergenic
1023057783 7:36303688-36303710 TGGAAGGAGCAGAGAGAGCCTGG - Intergenic
1023138819 7:37080781-37080803 GGGCTGAAGCAGAGAGAACCAGG - Intronic
1023520837 7:41048688-41048710 GGGCAGGAGAAGAGTAATACTGG + Intergenic
1023537811 7:41231928-41231950 GTGTGGGAGCAGAGTGAGGCCGG - Intergenic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1023881956 7:44325719-44325741 GTGCAGGAGCAGCGTGTGCAGGG - Intronic
1023934188 7:44727498-44727520 TGGCTGGAGCATAGTGAGCAAGG + Intergenic
1023940999 7:44768333-44768355 GGGAAGGAGCAGAGCGCGCAGGG - Exonic
1024247610 7:47482003-47482025 GGGCAGGGGCTAAGGGAGCCAGG + Intronic
1024251145 7:47506555-47506577 GGGCAGGAGCAGGGAGGTCCAGG - Intronic
1024266433 7:47610389-47610411 GAGCTGGAGCGGAGGGAGCCAGG + Intergenic
1024312886 7:47985885-47985907 AGGCAGGAGCACAGTGATCATGG + Intergenic
1024512268 7:50213312-50213334 GGGCAGGAGCAGGGTGTACATGG + Intergenic
1024784435 7:52890774-52890796 GGGCAGGGGCACAGTGGGGCAGG + Intergenic
1025021151 7:55481214-55481236 TGGCAGCAGGGGAGTGAGCCAGG + Intronic
1025022598 7:55491494-55491516 GGCCAGGTGTAGAGTGAGGCTGG - Intronic
1025954298 7:66170725-66170747 GGGCAGGGGCAGAGAGTCCCAGG + Intergenic
1026290761 7:69003709-69003731 TGGCTGGAGCTTAGTGAGCCAGG - Intergenic
1026913763 7:74107585-74107607 AGGCAGGAGGATTGTGAGCCAGG + Intronic
1026941562 7:74290305-74290327 GGGTAGGAGGAGATTGAGGCGGG + Intronic
1027268297 7:76505749-76505771 GGGGAGGAGGAGAGAGAGGCAGG - Exonic
1027722580 7:81763001-81763023 GGTTAGGAGCAGAGTGAGGTAGG + Intronic
1028441638 7:90869759-90869781 GGGCAGGAACAGCATGAGACTGG + Intronic
1028799642 7:94948258-94948280 GGGCAGGAGCAGGGAGGGACAGG + Intronic
1029273040 7:99388304-99388326 GGGCAGGACTAGAGTGTCCCCGG + Intronic
1029302749 7:99598207-99598229 GGGGAGGAGCCCACTGAGCCTGG - Intronic
1029347570 7:99989653-99989675 GGGCAGGAGGAGAGGGACACAGG + Intergenic
1029648186 7:101871531-101871553 GGGCACGTGCACAGTGAGACAGG + Intronic
1029655650 7:101922726-101922748 GGGCAGGGACAGGGTGTGCCTGG + Intronic
1029711288 7:102301331-102301353 GGGCAGCAGCTGAGGGTGCCAGG + Intronic
1030109239 7:106012486-106012508 TGGCAGGAGGAGAGTGAACAAGG + Intronic
1030640760 7:112003625-112003647 GGCCTGGAGCAGAGTTGGCCTGG + Intronic
1031076269 7:117215791-117215813 GGGCAGGGGCAGTGTGTGCTGGG + Intronic
1031133737 7:117862590-117862612 AGGGAGGAGCAGAGTGTGCCTGG - Intronic
1031801442 7:126251679-126251701 GGGAAGGAAGGGAGTGAGCCAGG - Intergenic
1031882120 7:127209547-127209569 TGGCAGGAGTGGAGTGAACCAGG + Intronic
1032415495 7:131732537-131732559 TGGCTGGAGCAGAGGGAGCTGGG - Intergenic
1032599291 7:133276127-133276149 GGGTAGGAGAAGAGAGAGACAGG - Intronic
1032832700 7:135644211-135644233 TGGCAGGAACAGGGTGAGGCAGG + Intronic
1033026794 7:137782251-137782273 GGGCATGATGAGAGTGAGACCGG + Intronic
1033562434 7:142545211-142545233 TGGCTGGAGCAGAGAGAGCCAGG - Intergenic
1034425277 7:151010700-151010722 GGGCTGGAGCAGAGGCAGCTGGG - Exonic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1034821928 7:154223841-154223863 AGGCAGGAGGGGAGTGAGCATGG + Intronic
1035389905 7:158497119-158497141 GGGAAGGAGGAGAGGGAGCAGGG - Intronic
1035432043 7:158829569-158829591 GGGCGGGAGCGGCGTGGGCCTGG + Exonic
1035471207 7:159109926-159109948 GGAGAGAAGCAGAGTGAGGCAGG + Intronic
1035658852 8:1331823-1331845 AGGCAGGAGCAGAGGGAGAGTGG + Intergenic
1035771850 8:2153834-2153856 GGCCTGGAGCAGAGTGAAGCAGG - Intronic
1036026564 8:4915571-4915593 GGGCAGGAGCAGGGACAGCTGGG + Intronic
1037477334 8:19270496-19270518 GTGGATGAGCAGAGAGAGCCAGG + Intergenic
1038184820 8:25263815-25263837 GGGGTGGAGCAGAGTGACCTGGG - Intronic
1039615532 8:38952178-38952200 GGGCAGGAAGGGAGTGAGCCCGG + Exonic
1041765911 8:61418079-61418101 GGGCAGTAGCAGGCAGAGCCGGG - Intronic
1042226880 8:66521144-66521166 GGGCAGCAGCAGGGTGAGGGTGG + Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1045242055 8:100411177-100411199 GAGGAGGAGGAGAGTTAGCCAGG - Intergenic
1045360060 8:101424799-101424821 GAGCAGGAGGAGAGTCATCCAGG - Intergenic
1045610105 8:103829714-103829736 GGGTAGGAGGAGAGTGAGCATGG + Intronic
1045951231 8:107853989-107854011 GGGAAGGAGCAGAATGTGGCAGG - Intergenic
1046490048 8:114939861-114939883 AGGCAGGAGAAGCGTGAACCCGG + Intergenic
1047324017 8:123819281-123819303 GGGAAGGAGCAGAGTCTGCAGGG + Intergenic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1047463277 8:125088933-125088955 TGGCTGGAGCAGAGTCAGCTAGG + Intronic
1047782423 8:128120840-128120862 GGGCAGGAGGAGAGAGAGATCGG - Intergenic
1047915845 8:129582978-129583000 TGGGAGGAGCACAGTGAGCAAGG + Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048244165 8:132775507-132775529 GAGCAGGAGCGGAGCGAGCTGGG - Exonic
1048815812 8:138332674-138332696 GGGAAGGAGAAGAGTGAACACGG + Intronic
1049014223 8:139908238-139908260 GGGCAGGTGCATGGTGGGCCTGG - Intronic
1049186614 8:141258273-141258295 GGCACGGAGCAGAGTGAGGCTGG - Intronic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049460388 8:142724620-142724642 GGGCAGGAGCAGAGGAGGTCTGG + Intergenic
1049555012 8:143277377-143277399 GGGCTGGTGCAGAGGAAGCCCGG - Intergenic
1049731734 8:144181670-144181692 GGGCAGCTGCATACTGAGCCAGG + Intronic
1049826236 8:144670599-144670621 TGGCAGGAGCCCAGGGAGCCTGG - Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052073856 9:24116921-24116943 GGGCAGGAGAAGACTCAGTCAGG + Intergenic
1052292032 9:26852975-26852997 AGGCAGGAGCAGAGAGAGCAAGG + Intronic
1052364617 9:27598018-27598040 GGACAGGAACAGAGAGAACCAGG - Intergenic
1052876447 9:33570298-33570320 GGGGAGGGACAGAGTGGGCCAGG + Intronic
1053121892 9:35553704-35553726 TGGCTGGAGCACAGTGGGCCAGG + Intronic
1053305379 9:36980980-36981002 TGGCAGGAGCAGAATAAGCGGGG - Intronic
1053499560 9:38574046-38574068 GGGGAGGGACAGAGTGGGCCAGG - Intronic
1053569474 9:39288749-39288771 GGCCAGGAGCAGGGAGAGGCCGG + Intergenic
1053753473 9:41279260-41279282 TGGCAGGAGCAGAGGGAGCCTGG + Intergenic
1053835435 9:42129770-42129792 GGCCAGGAGCAGGGAGAGGCCGG + Intergenic
1054091105 9:60847733-60847755 GGCCAGGAGCAGGGAGAGGCCGG + Intergenic
1054112516 9:61123289-61123311 GGCCAGGAGCAGGGAGAGGCCGG + Intergenic
1054127672 9:61330261-61330283 GGCCAGGAGCAGGGAGAGGCCGG - Intergenic
1054258995 9:62843623-62843645 TGGCAGGAGCAGAGCGAGCCTGG + Intergenic
1054332782 9:63776417-63776439 TGGCAGGAGCAGAGGGAGCCTGG - Intergenic
1054595190 9:67058840-67058862 GGCCAGGAGCAGGGAGAGGCCGG - Intergenic
1054850942 9:69846030-69846052 GGTCAGGAGAAGAGTAAGCTGGG + Intronic
1055711537 9:79067336-79067358 TGGCAGGAGTGGAGTGAACCAGG - Intergenic
1055781857 9:79829241-79829263 GAGAAGGAGCAGAGTGGCCCTGG - Intergenic
1056209060 9:84348118-84348140 GGCCAGGAGTAGGGTGAGCTAGG - Intergenic
1056222501 9:84464221-84464243 TGGCTGGAGCAGAGGGAACCAGG - Intergenic
1056276981 9:85002986-85003008 GGGACGGAGCTGAGTGAGCTTGG + Intronic
1056587159 9:87936173-87936195 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
1056793657 9:89641644-89641666 GGGGAGGAGAAGAGAGAGACGGG + Intergenic
1057214846 9:93222151-93222173 GGGAAGGGGCAGAGGGAGCAGGG - Intronic
1057240143 9:93400530-93400552 GGACAGGCGCACAGGGAGCCTGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057317229 9:93977454-93977476 AGGAAGGAGGAGAGTGGGCCTGG - Intergenic
1057678986 9:97158747-97158769 GGGGAGGCACAGAGTGGGCCAGG - Intergenic
1057734076 9:97637064-97637086 GTGCTGGAGCAGAGTGAGTGAGG + Intronic
1057962955 9:99474402-99474424 GGGGAGGAGGAGAGAGAGGCTGG - Intergenic
1058315843 9:103564909-103564931 GGGCAGGAACAGTGTCTGCCTGG - Intergenic
1058647621 9:107145318-107145340 GGGCAGGAGCAAAGTGAAGGAGG + Intergenic
1058848226 9:108983433-108983455 GAGAAGCAGCTGAGTGAGCCAGG - Intronic
1059414880 9:114156246-114156268 GGGCGGGGGCAGAGCCAGCCCGG + Intronic
1059424433 9:114211863-114211885 GGGCAGTGGCAGAGGGACCCTGG - Intronic
1059565452 9:115379744-115379766 TGTCAGGAGCAGAGAGAGGCTGG - Intronic
1060773012 9:126346458-126346480 GGACAGGAGCAGAGACAGCCAGG + Intronic
1060868817 9:127022613-127022635 TGGCTGGAGCAGAAGGAGCCTGG - Intronic
1060940835 9:127542056-127542078 GGGAAGGATCAGAGGCAGCCAGG - Intronic
1060991274 9:127850533-127850555 GAGCAGGAGCCGTGTGAACCAGG - Intronic
1061035187 9:128109542-128109564 AGGCAGGAGCGGGGTGAGGCTGG - Intergenic
1061350566 9:130061486-130061508 TGGCTGGAGCAGAGTGATCTAGG + Intronic
1061357663 9:130118729-130118751 GGGCAGGGGCAGGGGCAGCCTGG + Intronic
1061574431 9:131497202-131497224 GGGCAGGTCCAGGGTGAGGCTGG + Exonic
1061713873 9:132506454-132506476 GGGGAGGAGCAGGGAGGGCCCGG + Intronic
1061756966 9:132821268-132821290 GGGAAGGGACAGAGTGAGCGTGG - Intronic
1061905267 9:133693462-133693484 GGGCAGGGGCACAGTCAGCGGGG - Intronic
1061950417 9:133932890-133932912 GGCCAGGAGCAGAGGGAACCAGG + Intronic
1062156243 9:135050290-135050312 GGCCTGGCGCAGAGTGAGGCAGG + Intergenic
1062630552 9:137461314-137461336 GGGCAGGGGCTGGGTGACCCGGG + Intronic
1062658288 9:137615223-137615245 GGGCAGGTCCTGAGTGGGCCAGG - Exonic
1062719207 9:138026419-138026441 GGGGAAGAGCATAGGGAGCCTGG - Intronic
1203707286 Un_KI270742v1:63991-64013 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
1203548111 Un_KI270743v1:144579-144601 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
1185970172 X:4653999-4654021 GGACAGGAGAGGAGAGAGCCTGG + Intergenic
1186159935 X:6766735-6766757 GGGCAGGAGAAAAGTGAGTATGG - Intergenic
1186839547 X:13471423-13471445 GAGCTACAGCAGAGTGAGCCTGG + Intergenic
1187056150 X:15743085-15743107 TGGCAGGAGTAGAGTGAACCAGG - Intronic
1187472843 X:19584793-19584815 GGTGAGAAGCAGCGTGAGCCCGG + Intronic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1188811414 X:34657318-34657340 GGGCCGGGGCGGAGCGAGCCCGG - Intergenic
1188873844 X:35405859-35405881 GGTCAGGGGTATAGTGAGCCAGG - Intergenic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1190172127 X:48119993-48120015 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190189664 X:48266746-48266768 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1190196891 X:48327370-48327392 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190205949 X:48402755-48402777 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190217468 X:48489446-48489468 GGGCAGGAGCAGAGTGAACAAGG + Intergenic
1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190230178 X:48575823-48575845 GGGCAGCGGCAGACAGAGCCTGG + Intronic
1190232137 X:48590460-48590482 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190458558 X:50647894-50647916 GAGCTGGAGCACAGTGAGCAAGG + Intronic
1190658426 X:52633250-52633272 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190659907 X:52644756-52644778 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190676824 X:52789588-52789610 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1190737055 X:53262561-53262583 TGGAAGGAGCAGACTGGGCCAGG + Intronic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1191715800 X:64192709-64192731 GGGGCTGAGCAAAGTGAGCCAGG - Exonic
1192204813 X:69088797-69088819 GGGCAAGAGCAGAGGAAGGCTGG + Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1195171417 X:102272394-102272416 GGGCAGGTGGATAGTGACCCAGG - Intergenic
1195187443 X:102414705-102414727 GGGCAGGTGGATAGTGACCCAGG + Intronic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1196828539 X:119758976-119758998 GGGCAGCAGCAGGCTGTGCCTGG + Exonic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1197083501 X:122446300-122446322 GGGCAGGGTCAGAGTGAGACTGG + Intergenic
1198329174 X:135605879-135605901 GGACAGAGGCAGAGAGAGCCAGG - Intergenic
1198337371 X:135679700-135679722 GGACAGAGGCAGAGAGAGCCAGG + Intergenic
1198341633 X:135719971-135719993 GGACAGTAGCAGAGAGAGTCAGG - Intronic
1198346365 X:135763390-135763412 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198348271 X:135780675-135780697 GGACAGTAGCAGAGAGAGTCAGG + Intergenic
1198350173 X:135797938-135797960 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198352083 X:135815211-135815233 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198353991 X:135832479-135832501 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198355899 X:135849729-135849751 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198359728 X:135884290-135884312 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198361823 X:135903114-135903136 GGTCAGAGGCAGAGAGAGCCAGG - Intronic
1198366582 X:135946068-135946090 GGACAGTAGCAGAGAGAGTCAGG + Intergenic
1199716017 X:150507860-150507882 GGGCAGGGGCAGATGGAGGCTGG - Intronic
1199744848 X:150766044-150766066 AGGCAGGAGCAGAGTGCTGCGGG - Intergenic
1200167548 X:154047674-154047696 GAGCAAGAGCAGTGGGAGCCAGG + Intronic
1200326821 X:155249159-155249181 GTGCTAGAGCAGAATGAGCCAGG - Intergenic