ID: 1190222378

View in Genome Browser
Species Human (GRCh38)
Location X:48520685-48520707
Sequence ATCCCCCTCTAGGCCCCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190222378_1190222387 9 Left 1190222378 X:48520685-48520707 CCTGCTGGGGCCTAGAGGGGGAT 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1190222387 X:48520717-48520739 AACAGAGAAGGGGAGATCCAGGG 0: 1
1: 0
2: 3
3: 56
4: 377
1190222378_1190222383 -3 Left 1190222378 X:48520685-48520707 CCTGCTGGGGCCTAGAGGGGGAT 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1190222383 X:48520705-48520727 GATGCTTGGGGAAACAGAGAAGG 0: 1
1: 0
2: 0
3: 35
4: 410
1190222378_1190222385 -1 Left 1190222378 X:48520685-48520707 CCTGCTGGGGCCTAGAGGGGGAT 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1190222385 X:48520707-48520729 TGCTTGGGGAAACAGAGAAGGGG 0: 1
1: 0
2: 3
3: 40
4: 454
1190222378_1190222386 8 Left 1190222378 X:48520685-48520707 CCTGCTGGGGCCTAGAGGGGGAT 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1190222386 X:48520716-48520738 AAACAGAGAAGGGGAGATCCAGG 0: 1
1: 0
2: 1
3: 41
4: 380
1190222378_1190222384 -2 Left 1190222378 X:48520685-48520707 CCTGCTGGGGCCTAGAGGGGGAT 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1190222384 X:48520706-48520728 ATGCTTGGGGAAACAGAGAAGGG 0: 1
1: 0
2: 2
3: 26
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190222378 Original CRISPR ATCCCCCTCTAGGCCCCAGC AGG (reversed) Exonic
900463759 1:2813680-2813702 ATCCCCCTCTGGGCCCGGGAGGG - Intergenic
901176623 1:7305394-7305416 ACCCCCCACTAAACCCCAGCTGG + Intronic
902634086 1:17723866-17723888 ACACCCCTCAAGGCCCCTGCTGG - Intergenic
903183294 1:21615911-21615933 CTCCACCTCTAGGGCTCAGCTGG + Intronic
904310298 1:29625008-29625030 ATCTCCCTCCAGGCCTCACCTGG - Intergenic
904684096 1:32248352-32248374 CGCCCCCTCTCGGCCGCAGCGGG + Exonic
904768468 1:32868305-32868327 ATCCTCCTCCAGGTCCCAGAGGG + Exonic
905180231 1:36160981-36161003 ATCCCTCCCTCAGCCCCAGCAGG - Intronic
905300906 1:36985630-36985652 CTGCCCCTCAATGCCCCAGCAGG - Intronic
905889351 1:41509873-41509895 ACCCCCACCCAGGCCCCAGCAGG - Exonic
906652949 1:47526051-47526073 ATCCCCCACCAGTCACCAGCAGG - Intergenic
912480410 1:109978395-109978417 ATCCTCTACTAGCCCCCAGCAGG + Intergenic
912702293 1:111887470-111887492 AACCTCCTCTGGGGCCCAGCTGG + Intronic
912706830 1:111920885-111920907 ATCCCTCCCCTGGCCCCAGCAGG + Intronic
914913038 1:151802025-151802047 AGCCCCCGCAGGGCCCCAGCTGG + Exonic
915248696 1:154573191-154573213 ATCTCCCACTTGGCCTCAGCTGG - Intronic
916001401 1:160619875-160619897 ATCTCCCTCTGGTCCCCAGCAGG + Intronic
916812782 1:168319970-168319992 ATCTGCCACTAGGCCCCAGATGG - Intergenic
918042029 1:180919361-180919383 ACCCTCCTCTGGTCCCCAGCTGG + Intronic
920101876 1:203521974-203521996 AGCCCCAGCTATGCCCCAGCTGG + Intergenic
920378909 1:205524427-205524449 AATCCCATCTAGGCCTCAGCTGG - Intronic
1072427475 10:95342068-95342090 ATCCTCTTCTACGCCCTAGCAGG + Intronic
1073685215 10:105745138-105745160 ATCTCCCAATGGGCCCCAGCAGG - Intergenic
1075849258 10:125574036-125574058 TTCACCCTCGAGGCCCCAGAAGG - Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1083397087 11:62399673-62399695 AGGCACCTCTAGGACCCAGCGGG + Intergenic
1083460385 11:62807187-62807209 CTCCCCCACTGGCCCCCAGCTGG + Exonic
1085645678 11:78220928-78220950 ACCCCACTCTAGGCCACAGGTGG - Intronic
1086120210 11:83297991-83298013 ATCCTTCTCTAGGCCTCAGAGGG - Intergenic
1086378616 11:86227879-86227901 AACCACCTGTAGGCCCCAGAAGG - Intergenic
1090846249 11:130532363-130532385 ATTGCTCTCTAGTCCCCAGCTGG - Intergenic
1093822875 12:23643324-23643346 AACACCCTTTAGGCCCCACCTGG - Intronic
1101455140 12:104824246-104824268 AACCCCCCCGAGACCCCAGCAGG + Intronic
1101970631 12:109309784-109309806 CCCCCCCTCGCGGCCCCAGCAGG - Intergenic
1103269071 12:119657230-119657252 AACCCCCTATAGCCCACAGCTGG + Intergenic
1104768459 12:131345617-131345639 AATCCCCTCCAGGCTCCAGCTGG - Intergenic
1104811587 12:131622971-131622993 AATCCCCTCCAGGCTCCAGCTGG + Intergenic
1106081946 13:26507604-26507626 ATCCCCTTGTAGGGCCCTGCTGG - Intergenic
1108510203 13:51148793-51148815 CTCCGCCGCCAGGCCCCAGCTGG + Intergenic
1109389737 13:61677863-61677885 ATCCCCCAACAGGCCCCAGTGGG + Intergenic
1114559797 14:23581172-23581194 ATCCCCCACCAGGCCGCAGGTGG - Intergenic
1114615354 14:24065194-24065216 CTCCTCCTCTGGGCTCCAGCAGG - Exonic
1115752615 14:36506636-36506658 ATCCCTCTCTATGCCCCTCCAGG + Intronic
1115897638 14:38107208-38107230 AGCCCCTTCTACGCCCCAGCAGG + Intergenic
1117094295 14:52281972-52281994 ATCCCCATCTAGGCCTCTGTAGG - Intergenic
1120171333 14:81249340-81249362 ATCCTCCTCTAGGAACCAGCAGG - Intergenic
1121434830 14:93912204-93912226 AGCCACCTCTAGGCCCCTGCTGG + Intergenic
1122125958 14:99578957-99578979 ACCCTCCTCCATGCCCCAGCAGG - Intronic
1122198431 14:100107325-100107347 ATCCCCCTCAAAGCCTCTGCTGG + Intronic
1122825952 14:104370547-104370569 TGCTCCCTCCAGGCCCCAGCTGG + Intergenic
1122959806 14:105089285-105089307 AACTCCCTCTAGCCCCCAGATGG - Intergenic
1127968442 15:63941291-63941313 ACCCCGCTCCAGGCCCCACCAGG + Intronic
1128215778 15:65933173-65933195 TTCCCCCACCAGTCCCCAGCAGG + Intronic
1130662232 15:85839795-85839817 CTCCTGCACTAGGCCCCAGCAGG + Intergenic
1132153276 15:99477101-99477123 ATCCCCCACCAGGGCCCAGGCGG - Intergenic
1133270945 16:4610577-4610599 CTCACCCTCCAGGCCCCCGCCGG + Intronic
1133424508 16:5676082-5676104 CTGCCCCTCAATGCCCCAGCAGG - Intergenic
1136389145 16:29951379-29951401 GTCCCCCTCTGGCCCACAGCAGG + Intronic
1137584405 16:49655599-49655621 ATCCCCCTCAGTGCCCCAGCAGG - Intronic
1137755754 16:50900905-50900927 ATCTCCCACAAGTCCCCAGCAGG + Intergenic
1137789983 16:51166804-51166826 ATCCACCACTAGCCCCCACCAGG + Intergenic
1140065453 16:71607496-71607518 CTCCCTCCCTAGGCCTCAGCTGG + Intergenic
1141466713 16:84210876-84210898 ATCCACCTGTACTCCCCAGCAGG - Intergenic
1141952156 16:87346116-87346138 AACCCTCTGTAGGGCCCAGCCGG - Intronic
1142525288 17:535935-535957 GTTCCCATCCAGGCCCCAGCTGG - Intronic
1142554245 17:762471-762493 ATCACCATCCAGGCCCCGGCCGG + Intronic
1142554260 17:762539-762561 ATCACCATCCAGGCCCCGGCCGG + Intronic
1143100476 17:4501775-4501797 ATCCCCATCTCTGTCCCAGCTGG - Intronic
1147419985 17:40317785-40317807 ATCCTCTTCTAGGGACCAGCTGG - Intronic
1148128089 17:45247103-45247125 ATCCTCCTCTTGGCCACAGAGGG + Exonic
1148428658 17:47623808-47623830 ATCCCACTCTGGACCCCAGCGGG + Intergenic
1151743658 17:76000606-76000628 CTCCCCCTCCTGGCCCCCGCCGG - Intronic
1151878994 17:76883572-76883594 ATCCACCTCTAGGGGCCAGTTGG - Intronic
1155800031 18:30089727-30089749 ACCCCACTCCAGGCGCCAGCAGG - Intergenic
1156733367 18:40223168-40223190 ATCTCCCTCTTGGCCCCTACAGG - Intergenic
1160157227 18:76442974-76442996 ATCCACCTCGTGGCCCCGGCCGG + Exonic
1161270139 19:3385174-3385196 CTCCCCCAATTGGCCCCAGCAGG + Intronic
1161769961 19:6225692-6225714 AGACCCCTGGAGGCCCCAGCTGG - Intronic
1162364147 19:10237877-10237899 ACCCCCATCTCTGCCCCAGCAGG + Intergenic
1162925375 19:13928228-13928250 ATTCCCCTCTCAGCCCCACCTGG + Intronic
1163792577 19:19316392-19316414 GGCCCCATCCAGGCCCCAGCAGG + Intronic
1165138733 19:33686784-33686806 GTCCCCAGCAAGGCCCCAGCTGG - Intronic
1165950495 19:39471597-39471619 CTCCCCTTCTCGGCCCTAGCCGG - Exonic
1166380307 19:42352201-42352223 GTCCCCCTGTAGGCACCTGCAGG - Exonic
1166548443 19:43648860-43648882 ATCCCCCTCTCTGCCCTGGCTGG - Exonic
1168113771 19:54209474-54209496 CTCTCCCTGCAGGCCCCAGCGGG - Intronic
925722247 2:6840668-6840690 TCCCCTCTCTAGGTCCCAGCTGG - Intronic
926715535 2:15921040-15921062 ATCGTCCTCTAGACCCCAGTAGG + Intergenic
927217189 2:20674451-20674473 AGCCCCCGTTGGGCCCCAGCTGG - Intergenic
932502433 2:72195194-72195216 GTCTTCCTCTAGGCACCAGCTGG - Intronic
935268086 2:101411540-101411562 AACCTCCTCTTGCCCCCAGCTGG - Intronic
936508690 2:113128578-113128600 ATCCTCCTGGAGGCCCCAGCAGG + Intronic
937226680 2:120374430-120374452 ATCCCCTTCCAGGCCCCAGGGGG - Intergenic
947434837 2:230064371-230064393 ATCCCTTTCTAGCCCCAAGCAGG - Intronic
948832720 2:240606082-240606104 ATTCCTCTCTAGTCCCCAGCAGG + Intronic
948865820 2:240774276-240774298 ATCCCCCTCTGGGCACAACCTGG - Intronic
1168897523 20:1333984-1334006 CTCCCCATGTAGGTCCCAGCAGG - Intronic
1169455402 20:5748271-5748293 CTCCTCCACTAGGCCCCAGCAGG + Intergenic
1173364903 20:42376377-42376399 TTCCCTCTCCAGGCCACAGCTGG + Intronic
1173793667 20:45843942-45843964 CTCCCACTCTAGGCCCCAAAAGG + Intronic
1176123085 20:63462795-63462817 GTCCCCCTCTAGGCTCCGTCGGG - Intronic
1176220353 20:63966709-63966731 ATTCACCTCTAAGACCCAGCTGG - Exonic
1176884593 21:14240123-14240145 ATCCTCCTCTATGCTCCAGTTGG + Intergenic
1178050490 21:28741558-28741580 ACCCTCCACTAGGCCCCAGCGGG + Intergenic
1180731735 22:17987474-17987496 CTCTCCCTCTAGGCCACTGCTGG + Intronic
1181860462 22:25813888-25813910 ATCCTCCTCCCTGCCCCAGCTGG + Intronic
1182280376 22:29214857-29214879 ATCCTCCTGGAGTCCCCAGCAGG + Intronic
1183689786 22:39382119-39382141 CCCACCCTCTAGGCCCCTGCGGG - Exonic
1184347685 22:43923671-43923693 ATCCCCCTCCAAGCCCCGCCCGG + Intergenic
1185342768 22:50299107-50299129 ATCCCCATCTTGGCCCCTGCCGG - Intronic
1185374681 22:50476842-50476864 ATCCTCCTTTTTGCCCCAGCTGG + Intergenic
951909225 3:27731555-27731577 AACCCTCTTCAGGCCCCAGCTGG - Intergenic
952735598 3:36689002-36689024 GTCCTGCTCTGGGCCCCAGCAGG + Intergenic
955376754 3:58403615-58403637 AACCCCCTCTAGTACACAGCTGG + Intronic
962688391 3:137869035-137869057 GCTCCCTTCTAGGCCCCAGCAGG - Intergenic
963349202 3:144132032-144132054 ACCTCCCACTAGGCCCCACCTGG + Intergenic
966119788 3:176508921-176508943 CTCCTTCTCTAGGCCCAAGCTGG - Intergenic
967876507 3:194271469-194271491 AGCCCCCTCCAGGCCCAGGCTGG + Intergenic
967882860 3:194314121-194314143 ATCCCACTAGAGACCCCAGCAGG + Intergenic
970593326 4:17577767-17577789 ATCACCCCCTAGCCCCGAGCAGG - Intronic
979785623 4:124712618-124712640 ATCCTCCTCTTGGCCCCCGGCGG + Exonic
985801048 5:2005436-2005458 AGCCCTCTCTAGGGCACAGCGGG + Intergenic
991541456 5:67734120-67734142 CTCCTCCTCTAGGCTCAAGCTGG - Intergenic
997125143 5:131218764-131218786 ATCCCCCTCCTGTCCCCATCAGG - Intergenic
997596684 5:135111811-135111833 ATCCCCTTCTTGGGCCAAGCAGG - Intronic
998400520 5:141846456-141846478 ATCCACCCCTTGGCCCCTGCAGG + Intergenic
1001583992 5:172820441-172820463 TTCCCCCTCCATTCCCCAGCGGG - Intergenic
1002775576 6:325113-325135 ATGACTCTCTAGGCACCAGCAGG - Intronic
1005983826 6:30857774-30857796 CTCCCTCACTGGGCCCCAGCAGG - Intergenic
1006016322 6:31084090-31084112 ATCTCCCTCAGGGCCCCAGCAGG - Intergenic
1008637217 6:53423040-53423062 ATCCTGCTCTGGGCCCCAGGAGG + Intergenic
1015918131 6:138239055-138239077 TTCACCCTGAAGGCCCCAGCAGG - Intronic
1016074187 6:139776746-139776768 GTACCCCTCTAGGCCCTACCAGG - Intergenic
1019095987 6:169579518-169579540 AGCACCATCTTGGCCCCAGCTGG - Intronic
1019517071 7:1444824-1444846 GTCCGCCTCCAGGACCCAGCAGG - Exonic
1019631231 7:2050855-2050877 AACCCTCTCTAGGCCCCTCCTGG - Intronic
1019711698 7:2520960-2520982 ATTTCCCTCGAGGCCACAGCAGG + Intronic
1020023495 7:4883217-4883239 CTCCCCCTCCAGGGCACAGCCGG + Intronic
1025933961 7:66019086-66019108 ATCGTCCTGTAGGCCCCAGCTGG + Intergenic
1026209115 7:68287613-68287635 ATCCCCCACTGGGAACCAGCTGG + Intergenic
1033224967 7:139554225-139554247 ATGCCCCTCTCAGCCACAGCTGG - Intergenic
1033740686 7:144273586-144273608 AAACCCTTCTATGCCCCAGCTGG - Intergenic
1033753221 7:144376027-144376049 AAACCCTTCTATGCCCCAGCTGG + Intronic
1034163297 7:149007743-149007765 GTCCCTCTGTAGCCCCCAGCTGG + Intronic
1036621085 8:10424830-10424852 ATCTCCCTCCAGGGCCCTGCAGG - Intronic
1036827244 8:11986891-11986913 ATCCCCCTCTGGGCAACATCAGG + Intergenic
1041107819 8:54458986-54459008 CTCCCGCTCCAGGCCCCACCTGG - Intronic
1041262535 8:56034260-56034282 CTGACCCTCTAGGCCCCAGAAGG + Intergenic
1047629521 8:126692016-126692038 AGCCCCCTCAATGCCCCAGATGG + Intergenic
1053006280 9:34606942-34606964 TTCCTCCTGTAGGCCCCAGCTGG + Intergenic
1053527203 9:38842180-38842202 CTCCCCCTGAAGGCTCCAGCGGG - Intergenic
1054199426 9:62066611-62066633 CTCCCCCTGAAGGCTCCAGCGGG - Intergenic
1054638929 9:67521746-67521768 CTCCCCCTGAAGGCTCCAGCGGG + Intergenic
1056262395 9:84862070-84862092 TTCCCCCTCCAGGCCCCATCTGG - Intronic
1059773460 9:117450035-117450057 ATCCCCCTCTAGTCCCTCTCTGG - Intergenic
1060757264 9:126222966-126222988 GTCCCCCTCCAGGGCCCTGCCGG - Intergenic
1060996500 9:127877280-127877302 CTCCCTCTCTGGGCCCAAGCTGG + Intronic
1062187559 9:135226859-135226881 ATCGCCCTCTAGGACACAGGGGG - Intergenic
1187072667 X:15903589-15903611 CTTCCCCTCTTGACCCCAGCAGG + Intergenic
1190222378 X:48520685-48520707 ATCCCCCTCTAGGCCCCAGCAGG - Exonic
1192244283 X:69360099-69360121 AGCCTCCTTTAGGCCTCAGCTGG + Intergenic
1195341030 X:103906376-103906398 TTCCTCCTCTATGCCCCAGCAGG + Intergenic
1196351676 X:114738630-114738652 TGCCCCCTCTATGCCCCAACAGG - Intronic
1196834158 X:119799347-119799369 ATCCCCATCTACTCTCCAGCTGG - Intergenic
1200238761 X:154482791-154482813 GTCCTCCTCCAGGGCCCAGCTGG - Intergenic