ID: 1190223325

View in Genome Browser
Species Human (GRCh38)
Location X:48527275-48527297
Sequence GGTCTCTGTGGGTAAGGAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 282}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190223315_1190223325 10 Left 1190223315 X:48527242-48527264 CCAGCATCCCCTCCGCTTCATTC 0: 1
1: 0
2: 1
3: 25
4: 277
Right 1190223325 X:48527275-48527297 GGTCTCTGTGGGTAAGGAAAGGG 0: 1
1: 0
2: 2
3: 28
4: 282
1190223317_1190223325 2 Left 1190223317 X:48527250-48527272 CCCTCCGCTTCATTCTACAGCTT 0: 1
1: 0
2: 1
3: 4
4: 162
Right 1190223325 X:48527275-48527297 GGTCTCTGTGGGTAAGGAAAGGG 0: 1
1: 0
2: 2
3: 28
4: 282
1190223313_1190223325 20 Left 1190223313 X:48527232-48527254 CCTTTCTCCGCCAGCATCCCCTC 0: 1
1: 0
2: 1
3: 37
4: 388
Right 1190223325 X:48527275-48527297 GGTCTCTGTGGGTAAGGAAAGGG 0: 1
1: 0
2: 2
3: 28
4: 282
1190223318_1190223325 1 Left 1190223318 X:48527251-48527273 CCTCCGCTTCATTCTACAGCTTG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1190223325 X:48527275-48527297 GGTCTCTGTGGGTAAGGAAAGGG 0: 1
1: 0
2: 2
3: 28
4: 282
1190223316_1190223325 3 Left 1190223316 X:48527249-48527271 CCCCTCCGCTTCATTCTACAGCT 0: 1
1: 0
2: 0
3: 11
4: 181
Right 1190223325 X:48527275-48527297 GGTCTCTGTGGGTAAGGAAAGGG 0: 1
1: 0
2: 2
3: 28
4: 282
1190223314_1190223325 13 Left 1190223314 X:48527239-48527261 CCGCCAGCATCCCCTCCGCTTCA 0: 1
1: 0
2: 2
3: 26
4: 383
Right 1190223325 X:48527275-48527297 GGTCTCTGTGGGTAAGGAAAGGG 0: 1
1: 0
2: 2
3: 28
4: 282
1190223319_1190223325 -2 Left 1190223319 X:48527254-48527276 CCGCTTCATTCTACAGCTTGTGG 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1190223325 X:48527275-48527297 GGTCTCTGTGGGTAAGGAAAGGG 0: 1
1: 0
2: 2
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190223325 Original CRISPR GGTCTCTGTGGGTAAGGAAA GGG Exonic
901920854 1:12536493-12536515 AGTCTCTCTGGGTAGAGAAAAGG - Intergenic
902286505 1:15411203-15411225 GGTCCCTGTGGGGAGGGAAGGGG - Intronic
902339017 1:15770641-15770663 GGACTGTGTGGGGAATGAAATGG - Intronic
902617695 1:17632862-17632884 GGTCTGTGGGGGAAAGGCAAAGG - Intronic
902869824 1:19307261-19307283 GGCATCTGTGGGTCAGGAATAGG + Intronic
903045533 1:20561795-20561817 AATCTCTGTGGCTAAGGAGATGG - Intergenic
904801387 1:33095121-33095143 CCTCACAGTGGGTAAGGAAAAGG - Intronic
905028028 1:34864815-34864837 GGTCAGTGTGGGTCAGGCAAGGG - Intergenic
905163561 1:36060355-36060377 GATCTCTGTGTTCAAGGAAAGGG + Exonic
905951500 1:41955314-41955336 TGTCTCTGTGGGTTATGAATTGG + Intronic
906733529 1:48103151-48103173 GGGCTTTGTGGGAAAGGAAGTGG + Intergenic
907518341 1:55007360-55007382 GGACACTGGGGGTAAGGAGAGGG + Intronic
907564996 1:55426099-55426121 AGTCTCTGAGGGAAAGGGAAAGG - Intergenic
908416907 1:63922086-63922108 GGTTTCTATTGGTAAAGAAAAGG - Intronic
909655410 1:78026425-78026447 GTTCTATGAGGGTAAGGAACAGG - Intronic
911160007 1:94674769-94674791 GTTCTCTTTGGTAAAGGAAATGG - Intergenic
912163648 1:107016230-107016252 GGTTTCTCTGGGGAAGGCAAAGG + Intergenic
913119377 1:115725857-115725879 GCTATCTGTGAGGAAGGAAATGG - Intronic
914851097 1:151314850-151314872 AGCATCTGTGGGAAAGGAAAAGG - Intronic
915164563 1:153941390-153941412 GGTCTCTGTGGGGAAGGGAAGGG + Exonic
915838368 1:159196346-159196368 TGTGTCTGTGGAGAAGGAAATGG - Exonic
916502141 1:165396410-165396432 GGTGTAAGTGGGGAAGGAAAGGG - Intergenic
919240931 1:194914870-194914892 AGTTTCTGTGGGTGAGGAACTGG + Intergenic
920585399 1:207154237-207154259 GTTCTCTGGGAGTAGGGAAAGGG - Intergenic
920678657 1:208056482-208056504 GGTCTGTGTAGGAAAGGAGAAGG + Intronic
921392446 1:214630321-214630343 GGTCTCTGAGGGAAAGGGGAAGG - Intronic
922775237 1:228211498-228211520 GGTCCCTGTAGGTAGGGAGAGGG + Intronic
923393255 1:233535051-233535073 GGTCTCTGAGAGTAAAGAACCGG + Intergenic
924801315 1:247331337-247331359 GGTCGCTGTGGGCCAGGGAAGGG + Intronic
1062997608 10:1881686-1881708 GGTTTCTGTGGAAAAGGAAGAGG + Intergenic
1065302884 10:24340031-24340053 TGGTTCTGTGGGGAAGGAAAAGG + Intronic
1065900416 10:30201969-30201991 GGTCAATGAGGTTAAGGAAAGGG - Intergenic
1070911945 10:80126745-80126767 TGTCTCTCGGGGGAAGGAAAAGG - Intergenic
1071027208 10:81129217-81129239 TGTCTCTGTGGATTAGGGAATGG + Intergenic
1071092553 10:81935956-81935978 GCTCTCTGGGGGGAAGGAACTGG + Intronic
1072721957 10:97786701-97786723 GGCCTCTTTGGGTCAGGAAGGGG + Intergenic
1074382985 10:112995310-112995332 GGCCTCTGTGGGTAATGATGTGG - Intronic
1074473160 10:113745541-113745563 GGTCAGTGTTGGTAAGGAAGGGG - Intergenic
1075336819 10:121614731-121614753 GGTCCCTGTGGGTATGGACTGGG + Intergenic
1075342995 10:121662109-121662131 GGTCTTTCTGCGTAAGGCAAGGG + Intergenic
1075574806 10:123570659-123570681 GGTTGCTGTGGGCCAGGAAACGG - Intergenic
1075986777 10:126794663-126794685 GGACTCAGTGGGTAGGGGAAAGG + Intergenic
1076463964 10:130665831-130665853 GGGCTCAATGGGAAAGGAAAAGG + Intergenic
1078105394 11:8355130-8355152 GGTCTCTGTGGGAAAGTTGATGG - Intergenic
1084104180 11:66970110-66970132 GGTTTCTGTGGGTCAGGAATGGG - Intergenic
1087340961 11:96906550-96906572 ATTCTCTTTGGGGAAGGAAAAGG + Intergenic
1087450301 11:98312412-98312434 GGTCTCTCTGCATGAGGAAAGGG + Intergenic
1089639042 11:119834939-119834961 ACTCTCAGTGGGCAAGGAAAGGG + Intergenic
1090905094 11:131067967-131067989 GGGCTCTGTCAGGAAGGAAAGGG - Intergenic
1091693491 12:2612434-2612456 GGTCTGTGTGGCTGATGAAATGG - Intronic
1092223985 12:6734523-6734545 TGTTTCTGTGGGTAAGGAATCGG + Intergenic
1095386871 12:41661043-41661065 GGCATCTGTGGGTAAGGAGATGG - Intergenic
1095475389 12:42581956-42581978 GGTTTCTGTGGGTAAGGAAGGGG + Intronic
1095618895 12:44225686-44225708 GGTCTCTGAGGTTAATGAATTGG + Intronic
1096038709 12:48495166-48495188 GGTCTCTGTGGTCAAGACAAAGG + Intronic
1097281744 12:57848910-57848932 TGTCTCTATGGATGAGGAAATGG - Intergenic
1099468659 12:83019320-83019342 GGGAGCGGTGGGTAAGGAAATGG - Intronic
1101255676 12:102974317-102974339 GGATTCTGTGAGTAAGGAAGAGG + Intergenic
1101855818 12:108441950-108441972 GGTGTATGTGAGTAGGGAAATGG - Intergenic
1102246368 12:111358932-111358954 GTTCTCTGTGGGGAGGGAGAAGG - Intergenic
1102939484 12:116926699-116926721 GCTCTCTGTGGGCAAAGAGAAGG - Intronic
1103395393 12:120602990-120603012 GGTTTCTGTGGGCCAGGAATTGG + Intergenic
1103539047 12:121653255-121653277 GTTCTCTGGGGGAAAGGACAGGG + Exonic
1103780791 12:123397546-123397568 GCTCTCTGTGGGGAAGAAAATGG - Intronic
1103870966 12:124091400-124091422 AGTTTCTGTGGATAAGGACATGG - Intronic
1104568510 12:129904703-129904725 GGGCTCACTGGGAAAGGAAATGG + Intergenic
1105761771 13:23521860-23521882 TGACTATGTGGGGAAGGAAATGG + Intergenic
1105836472 13:24216581-24216603 GGTCTCTCTGTGTAAGGAGTAGG - Intronic
1106498659 13:30306948-30306970 GGGCTCTGTGCGTTGGGAAAGGG - Intronic
1109077434 13:57854550-57854572 TGTGTCTGTGTGTAAGTAAAGGG - Intergenic
1109232566 13:59776818-59776840 GCTCACTGTGGGAAAGAAAATGG + Intronic
1109297163 13:60548057-60548079 TTTCTCTGTGGGAAAGGAAATGG + Intronic
1110716469 13:78710471-78710493 AGTCTCTGTTAGTAAGGTAAGGG + Intergenic
1110927935 13:81179493-81179515 TGCCTCTGTGGGAAGGGAAATGG + Intergenic
1112624241 13:101084455-101084477 GTTAGCTCTGGGTAAGGAAAGGG - Intronic
1113400073 13:109983603-109983625 CGGCTCTGTGTGTAAGGGAATGG + Intergenic
1113873830 13:113582357-113582379 GCTCTGTGTGGCTTAGGAAAAGG - Intergenic
1114393624 14:22337051-22337073 GATCTCTGTGGGAAAGGAGCAGG + Intergenic
1115040140 14:28914383-28914405 TGTCTCTTTGGGAAAGAAAAAGG - Intergenic
1119177345 14:72578856-72578878 GGTCTTTCAGGGAAAGGAAATGG + Intergenic
1120192882 14:81455010-81455032 GGGATCTGTGGGTAAAGAAGAGG - Intergenic
1121936061 14:98020034-98020056 GGTTTCTGTGGGTCAGGAGTAGG + Intergenic
1122063160 14:99150463-99150485 GGATTCTGTGTGTAAGGCAATGG + Intergenic
1122344456 14:101049935-101049957 GGTCCCTGGGGGCAAGGACAAGG + Intergenic
1123065538 14:105617157-105617179 GGTCTCTGTGGCCAAGGGAAGGG - Intergenic
1123069735 14:105636622-105636644 GGTCTCTGTGGCCAAGGGAAGGG - Intergenic
1123088817 14:105732341-105732363 GGTCTCTGTGGCCAAGGGAAGGG - Intergenic
1123401767 15:19994477-19994499 GATCACTGTGGATAATGAAAAGG + Intergenic
1123511107 15:21001138-21001160 GATCACTGTGGATAATGAAAAGG + Intergenic
1124259736 15:28178111-28178133 GGGTTCTGTTGGTAAGGAAGGGG - Intronic
1128193867 15:65732768-65732790 GGTCTCTGAGGAGATGGAAAAGG + Exonic
1129152036 15:73695341-73695363 GGTCTCTGGAGTTCAGGAAAGGG + Intronic
1129265281 15:74389959-74389981 GGCCTCTGTGGGTCACGACAGGG - Intergenic
1130333383 15:82938562-82938584 GGAGTCTGAGGGTAAAGAAAAGG - Intronic
1132609874 16:810320-810342 GGTTGCTGTGGGTGAGGAACGGG + Intronic
1135263354 16:21000212-21000234 GGTGTTTGTGGGTAAGGCATTGG - Exonic
1136552058 16:30986992-30987014 GGTCTATGTGGGTGAGGACTGGG + Exonic
1137468822 16:48736167-48736189 GATCTCTGTGGCAGAGGAAAAGG + Intergenic
1137812287 16:51364281-51364303 GGTCTCTGTGGGTCATGGAATGG + Intergenic
1138227705 16:55311982-55312004 GGGGCCTGTGGGTAGGGAAAAGG - Intergenic
1138475056 16:57265717-57265739 GGTCACTGTGGGTAAAGGACAGG + Intronic
1138876151 16:60952804-60952826 GGACTTTGTGGCTAAGGATAGGG - Intergenic
1140215199 16:73001397-73001419 AGTTTCTGTGGGTCAGGAATCGG - Intronic
1140772790 16:78221475-78221497 GGACTCTGTGGGTAGAGACATGG + Intronic
1140817868 16:78637584-78637606 GATGTCAGTGAGTAAGGAAAGGG - Intronic
1141976608 16:87520480-87520502 GGACTCTGGGGGTCAGGACAAGG - Intergenic
1143103588 17:4517219-4517241 GGCCTCTATGGGGAAGGAAGTGG - Intronic
1143249887 17:5515295-5515317 GGTCTCTGTGGATAGGACAAGGG + Intronic
1143398800 17:6626817-6626839 AGTCTCTGTGGGGAAGGACTGGG - Intronic
1143682709 17:8489269-8489291 AGTTTCTGTGGGTGAGGAATTGG - Intronic
1143784922 17:9248974-9248996 GGTCTCTCTGGCAAAGGACAAGG - Intergenic
1144097246 17:11911206-11911228 TGTTTCTGTATGTAAGGAAAGGG + Intronic
1144254844 17:13457498-13457520 GGTCTCTCTGGATAAATAAAAGG + Intergenic
1145304323 17:21664592-21664614 GCACTCTGTGGGAAGGGAAAAGG + Intergenic
1145406890 17:22607630-22607652 GGTCTCTTTGGGGAAGGCATGGG - Intergenic
1145912135 17:28548926-28548948 GGTCTCTGGGGGCCAGGGAAGGG + Intronic
1146519793 17:33517464-33517486 GGTTTCTGTGGGTCAGGAGTTGG + Intronic
1147861797 17:43528213-43528235 GTTCTCTGTGGTTGGGGAAAAGG + Exonic
1148893970 17:50829307-50829329 TGTCTCTGTGGGTTAGAACATGG + Intergenic
1149161004 17:53692902-53692924 GATCTCTGTGTGTAATGAAAAGG - Intergenic
1149556549 17:57577421-57577443 GGGCTCTATGGGTCTGGAAATGG - Intronic
1151478479 17:74356600-74356622 GGTCCCTGTGGGTCTGGGAAGGG - Exonic
1151659633 17:75512038-75512060 GGTCTCTGTGCCTAGGGAAGTGG - Intronic
1152091652 17:78250784-78250806 GCCCTCTGTGGGTCAGGAAGAGG + Intergenic
1153942248 18:9988375-9988397 GGTCTGTGTGGGGGAGGAGAAGG - Intergenic
1157929541 18:51806182-51806204 TGTCTCTGTAGGTAAAGGAAAGG - Intergenic
1158049633 18:53201115-53201137 GGTATCTGGGGGAAGGGAAAGGG - Intronic
1158813107 18:61060404-61060426 GGTCCCTGTAGGTAAAGAAATGG + Intergenic
1158831644 18:61285978-61286000 GGGCACTGTGTGTTAGGAAATGG + Intergenic
1159012684 18:63072914-63072936 AGTATCTTTGGGTAAGTAAAAGG + Intergenic
1160035569 18:75298743-75298765 TGTGTCTGTCTGTAAGGAAAGGG + Intergenic
1161412109 19:4122823-4122845 GGTCCCTGTGGGAAAAGACAGGG - Intronic
1161651060 19:5485330-5485352 GGCCTCAGTGGGTCAGGGAAGGG - Intergenic
1161734635 19:5983955-5983977 AGTTTCTGTGGGTGAGGAATGGG - Intergenic
1161769532 19:6223768-6223790 GGTCTCTGTAGGGAAGGTGAAGG - Intronic
1162321163 19:9971134-9971156 GGTCTGTGGGGGTAGGGAGATGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1163743802 19:19033230-19033252 GGCCTCTGCGGGCGAGGAAATGG + Intronic
1164784130 19:30916381-30916403 GAGCCCTGTGGGAAAGGAAAAGG + Intergenic
1166074370 19:40405126-40405148 GGTCTGCGTGGGTAATGAATGGG + Intronic
1167608792 19:50496297-50496319 GGTCTCTCCTGGGAAGGAAACGG - Intergenic
1168108558 19:54179406-54179428 GATCTTTGTTGCTAAGGAAAAGG + Intronic
1168176381 19:54630817-54630839 GGTGGCTGGGGGTCAGGAAAGGG + Intronic
925623772 2:5821317-5821339 GAACTCTGTGAGAAAGGAAATGG - Intergenic
926092333 2:10058954-10058976 GGGCTCTGTGGGTCAGAAATGGG + Exonic
926705526 2:15834835-15834857 GGGCTCACTGGGTAAGGAAGAGG - Intergenic
928078478 2:28287086-28287108 GGTGTCTGTGGTTAAAGTAAAGG - Intronic
928916687 2:36479543-36479565 GGTCTCCGTGGGCAAGGATCAGG - Exonic
931544559 2:63368129-63368151 CATATCTGTGGGGAAGGAAAAGG + Intronic
932505781 2:72230080-72230102 AGTCTCTGTGGGAAAAAAAAAGG + Intronic
933097316 2:78203156-78203178 GATTTCTGTGGGTAGGAAAATGG - Intergenic
933170667 2:79121514-79121536 AGGCTCTCAGGGTAAGGAAAAGG - Intronic
934950392 2:98571677-98571699 GGTCTCTGAGGCTGAGGAGATGG + Intronic
936112835 2:109678810-109678832 AGTCTCTGTGGGTACAGAGAAGG + Intergenic
937886257 2:126901710-126901732 GGTCCCTGTGGGTCAGGGCAGGG - Intronic
939213627 2:139210496-139210518 AGTCTCTTTGGGGAAGGATAGGG - Intergenic
941370393 2:164657447-164657469 GGATTCTGTGGGTAAGGAATTGG - Intronic
941606502 2:167604177-167604199 GGCCTCTTTGGGTAAAGGAAAGG + Intergenic
941856177 2:170233531-170233553 GGTCTTTGGGGGCAATGAAATGG + Intronic
942169174 2:173273061-173273083 GGTGTCTTTGGGTAAGAGAAAGG - Intergenic
942579680 2:177404269-177404291 GGTCTATGGGGGTAATGAGAAGG + Intronic
945049295 2:205807869-205807891 GGTACCAGTGGGTAAGGACAAGG - Intergenic
945672172 2:212815599-212815621 GGTTTCTGTGGGTGCAGAAATGG - Intergenic
945851867 2:215017739-215017761 GCCATCTGGGGGTAAGGAAAAGG + Intronic
948197643 2:236107242-236107264 GGCCTCTCTGGGCAAGGACATGG - Intronic
1168767611 20:392388-392410 TTTCTCCGTTGGTAAGGAAAAGG + Intronic
1168769222 20:403921-403943 AGTTTCTGTGGGTTAGGAACTGG - Intergenic
1169422790 20:5473294-5473316 GCTCACTGTGGCTGAGGAAAGGG - Intergenic
1169426635 20:5502181-5502203 GCTCACTGTGGCTGAGGAAAGGG + Intergenic
1169886284 20:10402155-10402177 GATCGCTGTGGAAAAGGAAAGGG - Exonic
1170647375 20:18209427-18209449 GGTCTGTGTGGGTGTGGAGAAGG - Intergenic
1171292980 20:23993326-23993348 GGTGTCTGCAGGTGAGGAAAGGG - Intergenic
1171521850 20:25782131-25782153 GCACTCTGTGGGAAGGGAAAAGG + Intronic
1171554975 20:26073752-26073774 GCACTCTGTGGGAAGGGAAAAGG - Intergenic
1171969574 20:31555416-31555438 TGTGTCTGTGGGTATGGACACGG + Intronic
1172319133 20:33982662-33982684 GGTCCCTGTGGGTCAGTAAGTGG + Intergenic
1172770662 20:37380673-37380695 GGTCTCTGGGGGCATGGAGATGG + Intronic
1173638342 20:44580824-44580846 GCTCTCTATAGGTAAGGAAGAGG - Intronic
1174063490 20:47848434-47848456 GGTATCTGTGTGTGAGCAAATGG + Intergenic
1176297660 21:5082855-5082877 GTTCTCTGAGGGTAAGGACAGGG - Intergenic
1176655650 21:9587067-9587089 GCACTCTGTGGGAAGGGAAAAGG + Intergenic
1176893220 21:14344517-14344539 GTCCACTGTGGGTCAGGAAAGGG + Intergenic
1178818449 21:35952872-35952894 GGTTTCTGGAGGGAAGGAAATGG + Intronic
1179401363 21:41086973-41086995 GTTCTCTGTTGGAAAGGAAATGG - Intergenic
1179507526 21:41851729-41851751 GGGCTCTCTCGGGAAGGAAAGGG + Intronic
1179859369 21:44179094-44179116 GTTCTCTGAGGGTAAGGACAGGG + Intergenic
1181399009 22:22639905-22639927 GGTGTCTGCAGGTGAGGAAAGGG + Intergenic
1183224412 22:36539633-36539655 AGTTTCTGTGGGTCAGGAATTGG + Intergenic
949752876 3:7374994-7375016 AGTCACTGTGGGTGAAGAAAAGG - Intronic
949809564 3:7991725-7991747 GGTCTGAATGGGGAAGGAAAAGG - Intergenic
949818928 3:8093995-8094017 GGTATGTGTGAGTAAGGAAAGGG + Intergenic
950111986 3:10424925-10424947 GGTATCTCTGGGGAAGGGAAAGG + Intronic
952718258 3:36504253-36504275 GGTCACAGAGGGTGAGGAAAAGG + Intronic
954916992 3:54156868-54156890 GGTTTCTGTGGGTCAGGAATTGG - Intronic
960431644 3:117576546-117576568 TGGATCTGTGTGTAAGGAAAGGG - Intergenic
960600509 3:119453386-119453408 GGTGTCAGAGGGAAAGGAAATGG + Intronic
960952613 3:123009324-123009346 GGGGACTGTGGGTAAGGGAAGGG + Intronic
962040791 3:131705559-131705581 GGCCACTCTGGGGAAGGAAAGGG + Intronic
962622573 3:137194326-137194348 GGGCTCTGTGGGAAAAGGAAAGG + Intergenic
963005649 3:140724190-140724212 GGTCACTGTGGGAGAGGGAAGGG - Intergenic
964085148 3:152808255-152808277 GAACTCTGAGGGTTAGGAAATGG - Intergenic
965122037 3:164572487-164572509 GATCTCTGTAAGTCAGGAAATGG - Intergenic
965358519 3:167708473-167708495 GTTCACTGTGGGTAGGGAGAGGG - Intronic
967357265 3:188585989-188586011 GGTCTCTTTGGGGCAGGAAGAGG + Intronic
967829434 3:193906135-193906157 GGTATCTGAGGGTGAGGAAAGGG + Intergenic
967947883 3:194818544-194818566 GGTCTCTGTGGGCAGGGGGAAGG - Intergenic
972025533 4:34371731-34371753 GGTCTCTGAAGGTCTGGAAAGGG + Intergenic
973585877 4:52390591-52390613 GGCCTCTTTGGGAAATGAAATGG + Intergenic
973767548 4:54177012-54177034 AGTCACTGTGGCTAAGGGAAGGG + Intronic
975425907 4:74227286-74227308 GGTCTGTAGGGGTGAGGAAATGG - Intronic
976081897 4:81365103-81365125 CGTCACTGTGGGTAATGAAAGGG + Intergenic
977068897 4:92357477-92357499 TCACTCTGTTGGTAAGGAAAAGG + Intronic
977806435 4:101304413-101304435 GGTCTCTATTGGCACGGAAATGG - Intronic
978578683 4:110211246-110211268 GGCCTCTCTGGGAAAGGAGATGG + Intergenic
979953629 4:126926682-126926704 GGGGTCGGTGGGTAAGGCAAGGG + Intergenic
981848198 4:149194501-149194523 GGGATCTGTGCGTAAGAAAATGG + Intergenic
982284818 4:153724123-153724145 GGTCTAAGTGGAGAAGGAAAAGG + Intronic
983390236 4:167121707-167121729 GTTCTCTAAGGGTGAGGAAATGG - Intronic
986249335 5:6042505-6042527 GGTCGCTGTGGGTGGGGAGAGGG + Intergenic
990095741 5:52110062-52110084 TGTCTTTGTGGGTAAGAATAAGG - Intergenic
990972998 5:61530036-61530058 GGTAGCTCTGTGTAAGGAAAGGG - Exonic
993088279 5:83392121-83392143 GGTCTCAGTGTGTGAGGCAAAGG + Intergenic
994055090 5:95405960-95405982 GGACTGTGTTGGTAAGGAATTGG - Intronic
994296804 5:98099596-98099618 GGTCATTGTGGGTGAGGAAAAGG - Intergenic
996678273 5:126201704-126201726 AGTTTCTGTGGGAAGGGAAATGG + Intergenic
996712189 5:126554280-126554302 GGTCTATGGGGGCAAGGTAAGGG - Exonic
997840358 5:137234097-137234119 GGTGTCTCTGGGTAGGGAAAAGG + Intronic
1000222159 5:159224517-159224539 GGGCCCTGTGGGCAAGGAACAGG - Intergenic
1000292187 5:159880787-159880809 GGCCTGGCTGGGTAAGGAAATGG - Intergenic
1001752754 5:174144198-174144220 AGTTTCTGTGGGTCAGGAATTGG + Intronic
1003013439 6:2448299-2448321 GTTTACTGTGGGAAAGGAAAAGG + Intergenic
1003207147 6:4023041-4023063 GTGCTCTGTGGGGAAGGGAAGGG - Intronic
1005271027 6:24163810-24163832 GGTCACTTTGGGGAAGGACACGG + Intergenic
1005939780 6:30552455-30552477 CGGCTGTGTGGGTAAGGAAGTGG - Exonic
1006133698 6:31883331-31883353 GGTGTCTGTGGCCAAGGCAAGGG + Intronic
1006143236 6:31943517-31943539 GGTCAATGTGGGTAAGGCAGGGG + Exonic
1006395430 6:33784025-33784047 GGTCTCTGTTGGCATGGGAAGGG - Intronic
1007690309 6:43696742-43696764 GTTTTTTGTGTGTAAGGAAAAGG + Intergenic
1007980950 6:46157670-46157692 GGTATCTCTTGGTAGGGAAATGG + Intergenic
1008063817 6:47026581-47026603 CTTCTCTGTGGGGAAAGAAAAGG - Intronic
1008122213 6:47631750-47631772 TGTCTCTTTAGATAAGGAAAGGG - Intergenic
1009211057 6:60863660-60863682 GGTTTCTGTGGGTCAGGAGTTGG + Intergenic
1009836593 6:69009053-69009075 GCCCACTGTGTGTAAGGAAATGG - Intronic
1012468774 6:99546394-99546416 GCTTTCTGTGGATATGGAAAAGG - Exonic
1012726680 6:102822256-102822278 GGACTCTGTGACTAAAGAAAAGG + Intergenic
1014135106 6:117879909-117879931 TGGATCTCTGGGTAAGGAAAGGG - Intergenic
1014265149 6:119268992-119269014 GGAAGCTGGGGGTAAGGAAACGG - Intronic
1014787720 6:125637540-125637562 GGCCTCTTTGGGTAAAGAATGGG + Intergenic
1015450983 6:133365634-133365656 GGTTTCTGTGGGAAAGGGAAGGG + Intronic
1015537168 6:134277757-134277779 GGTTTCTATGGGTAAGAATAAGG + Intronic
1017119431 6:151009801-151009823 GGTCACTGTGGGGAAGCAAGTGG - Exonic
1020768190 7:12352564-12352586 GGTCTGTTTGGGAAAGAAAACGG + Intronic
1020796658 7:12685665-12685687 GGCCTCTGTTGGTAAGAAAATGG - Intergenic
1022781334 7:33587360-33587382 GCTCTCTCTGGTTAAGGAAAGGG - Intronic
1026366085 7:69649959-69649981 AGACTGTGTGGGGAAGGAAAAGG - Intronic
1028231863 7:88315443-88315465 GGTGACTGTTAGTAAGGAAAAGG - Intergenic
1029518478 7:101043721-101043743 GGTCACCGTGGGGAAGGAAGTGG - Exonic
1031342619 7:120622655-120622677 TGTGTGTGTGTGTAAGGAAAAGG - Intronic
1032196762 7:129793931-129793953 GGTCTCTGTGGGAAGGGCCATGG - Intergenic
1032998138 7:137471212-137471234 GGTCTCTGTGGGGAAGACACTGG + Intronic
1034145088 7:148863212-148863234 GTTCTCTGTGAGTCAAGAAAAGG - Intronic
1034198661 7:149266935-149266957 GGTCTCCCTGGGTAAGGCCACGG + Exonic
1034918569 7:155060505-155060527 GGTCTCTCTGGGAAAGGACTAGG + Intergenic
1035021538 7:155803722-155803744 GTTCTCTGCGGGTGAGGAGAAGG + Exonic
1035029378 7:155847459-155847481 GGTCTTTGTGGGTTGGGAAAGGG + Intergenic
1036703740 8:11031278-11031300 GGTCACTGTGGATTAGGAGATGG - Intronic
1036716080 8:11125294-11125316 GGTCTCTGTACGTAAGGAGATGG - Intronic
1037631180 8:20657772-20657794 GGGCTCTGTTAGTAAGGATAGGG - Intergenic
1038083550 8:24167889-24167911 TGTTCCTGTGGGTAATGAAATGG - Intergenic
1038391767 8:27208489-27208511 GTTCTCTGTAGGGAAGGACATGG - Intergenic
1038403095 8:27300313-27300335 AGTTTCTGTGGGTCAGGAATTGG - Intronic
1039140322 8:34380307-34380329 GGTCAGCGTGGGTTAGGAAAAGG + Intergenic
1041412762 8:57574940-57574962 TTTCTCTGTGAGTAAGGACAAGG + Intergenic
1042953240 8:74222135-74222157 GGTGGCTGTGGGAATGGAAAAGG + Intergenic
1043492128 8:80760127-80760149 AGTATCTGTGGGTCAGGAATAGG - Intronic
1044282377 8:90371231-90371253 GGTGTCTCTGGGTAGGGAAGAGG - Intergenic
1047663011 8:127059096-127059118 GGTCCCTGTAGGGAAGGAAGTGG - Intergenic
1047704349 8:127482718-127482740 GGACTCTCTGGATAAGGAGATGG - Intergenic
1047765136 8:127984330-127984352 CGTCTCTGTAGATAAGAAAACGG + Intergenic
1048981954 8:139707186-139707208 GGCCTCTCTGGGTAAGAACAGGG - Intergenic
1050529479 9:6575890-6575912 GGGCTCAGTGGGAAATGAAAAGG + Intronic
1051648726 9:19298084-19298106 GGTCTTTGTGGTGAAGGAAAAGG - Exonic
1051896222 9:21992039-21992061 GGTTTCTGTGGTTAAGAAACTGG + Intronic
1053209270 9:36213729-36213751 GGTTTCTGTGGGTCAGGATTTGG - Intronic
1053296102 9:36913839-36913861 GGGCTTTGTGGGGAGGGAAAAGG + Intronic
1053488003 9:38475740-38475762 TGTATCTGTGTGTAATGAAAAGG + Intergenic
1055391704 9:75828683-75828705 GGTCTCCCTGAGTAAGGATATGG - Intergenic
1056403046 9:86247022-86247044 GGTCTCTTTGGGGAAGCCAAAGG + Intronic
1056941314 9:90958862-90958884 TGTCTCTGTTGTTGAGGAAATGG - Intergenic
1057416860 9:94871480-94871502 AATCTCTGTGGTAAAGGAAATGG - Intronic
1057668369 9:97065011-97065033 TGTATCTGTGTGTAATGAAAAGG + Intergenic
1059161515 9:112039560-112039582 GGTCTCTGGGGGTTAGGATGGGG + Intergenic
1061215982 9:129222318-129222340 GGTCTCTGTGGGCCAGGGCAGGG + Intergenic
1061679259 9:132234887-132234909 GGTGGCTGTGGGGAAAGAAAAGG - Intronic
1061880755 9:133567767-133567789 GGGCTCTGAGGGGAAGGACAGGG - Intronic
1062154330 9:135038053-135038075 GGTCCCTGTGGGGAAGGAGAGGG + Intergenic
1203756765 Un_GL000218v1:137448-137470 GGACTCTGTGGTTAATAAAATGG + Intergenic
1203633363 Un_KI270750v1:90482-90504 GCACTCTGTGGGAAGGGAAAAGG + Intergenic
1188401448 X:29750093-29750115 AGGCTCTTTGGGTAAGGAGATGG - Intronic
1189117018 X:38353379-38353401 TGTGTCTGTGGGGAAGGGAAAGG + Intronic
1190066818 X:47247286-47247308 GGTCCCTGTGGGTGGGGAGAGGG - Exonic
1190223325 X:48527275-48527297 GGTCTCTGTGGGTAAGGAAAGGG + Exonic
1190560474 X:51681352-51681374 AGTGTCTCTGGGTAAGGAGATGG - Intergenic
1190563817 X:51711969-51711991 AGTGTCTCTGGGTAAGGAGATGG + Intergenic
1191011601 X:55765381-55765403 GGTCTCTGTGATGATGGAAATGG + Intergenic
1191894699 X:65979768-65979790 GGTTTCTGTGGGCAAAGAATTGG - Intergenic
1192751223 X:73994027-73994049 GTTCTGTGAGGGTAAAGAAAAGG - Intergenic
1194152112 X:90338702-90338724 GGTCTGTGTGGGTCATGATATGG - Intergenic
1196892213 X:120302325-120302347 AGTCTCTGTGGGTGAGGGGAAGG - Intronic
1197056904 X:122132610-122132632 TGTTTCTGTGGGGAAGAAAATGG + Intergenic
1197380179 X:125729322-125729344 GGTAACTGTGCGTTAGGAAAAGG - Intergenic
1199725334 X:150574341-150574363 GGTCTCAGTGGGTGAGGATGGGG - Intronic
1200797256 Y:7352336-7352358 GGTCTCTGGGGATCAGTAAATGG + Intergenic