ID: 1190224369

View in Genome Browser
Species Human (GRCh38)
Location X:48534029-48534051
Sequence CCTTATAAGAAGAGGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190224369_1190224374 0 Left 1190224369 X:48534029-48534051 CCAGTGTCCCTCTTCTTATAAGG No data
Right 1190224374 X:48534052-48534074 ATACCAGTTCTACTGAATTAGGG No data
1190224369_1190224373 -1 Left 1190224369 X:48534029-48534051 CCAGTGTCCCTCTTCTTATAAGG No data
Right 1190224373 X:48534051-48534073 GATACCAGTTCTACTGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190224369 Original CRISPR CCTTATAAGAAGAGGGACAC TGG (reversed) Intergenic
No off target data available for this crispr