ID: 1190229694

View in Genome Browser
Species Human (GRCh38)
Location X:48572755-48572777
Sequence GAGGAATCCCTGACAATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190229692_1190229694 4 Left 1190229692 X:48572728-48572750 CCTAAGGGATTAATAATTAGACT No data
Right 1190229694 X:48572755-48572777 GAGGAATCCCTGACAATAACAGG No data
1190229691_1190229694 10 Left 1190229691 X:48572722-48572744 CCAACACCTAAGGGATTAATAAT No data
Right 1190229694 X:48572755-48572777 GAGGAATCCCTGACAATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190229694 Original CRISPR GAGGAATCCCTGACAATAAC AGG Intergenic
No off target data available for this crispr