ID: 1190233418

View in Genome Browser
Species Human (GRCh38)
Location X:48599177-48599199
Sequence CAGGAACAGCAGAACTCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190233410_1190233418 10 Left 1190233410 X:48599144-48599166 CCTGTCTTTAGTATCTGCTGAGC 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1190233418 X:48599177-48599199 CAGGAACAGCAGAACTCGTGAGG 0: 1
1: 0
2: 2
3: 8
4: 99
1190233409_1190233418 11 Left 1190233409 X:48599143-48599165 CCCTGTCTTTAGTATCTGCTGAG 0: 1
1: 0
2: 2
3: 14
4: 217
Right 1190233418 X:48599177-48599199 CAGGAACAGCAGAACTCGTGAGG 0: 1
1: 0
2: 2
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190233418 Original CRISPR CAGGAACAGCAGAACTCGTG AGG Intronic
900318955 1:2073112-2073134 CAGGCACAGCACAGCCCGTGAGG + Intronic
900586593 1:3435417-3435439 CAGGGACAGCAGGATTCATGGGG - Exonic
903564605 1:24255270-24255292 CAGGAATAGCAAAACTCCAGGGG - Intergenic
905712502 1:40118307-40118329 AAGGAACAGCAGATGTCTTGAGG - Intergenic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
908407075 1:63825544-63825566 TAGGAGCAGCAGAACTTTTGGGG + Intronic
913103934 1:115594877-115594899 TAGGGACAGCAGCACTCCTGGGG - Intergenic
917966446 1:180182148-180182170 CAGGGACAGCAGAACATCTGGGG - Intronic
919473056 1:198002527-198002549 CAGGAACAGCTGCCCTAGTGGGG + Intergenic
920572663 1:207029396-207029418 CAGGAACATGAGAAATCATGTGG + Intronic
920798499 1:209163756-209163778 CAGAAACAGCAAAAGTGGTGGGG - Intergenic
1064254412 10:13731943-13731965 CAGGAACAGCTGAACACGTGGGG - Intronic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1079347084 11:19662541-19662563 CAGGAATGGAAGAACACGTGGGG - Intronic
1085417734 11:76330398-76330420 CAGGAACAGCAAAGGGCGTGAGG - Intergenic
1086993826 11:93334030-93334052 AAGGAACAGTAGAACTTGTTTGG + Intronic
1087934192 11:104013153-104013175 CTGGGACAGCAGAACTCCAGGGG + Intronic
1091780288 12:3209586-3209608 CAGGTACAGCTGAGCTCGTCAGG - Intronic
1092902958 12:13076863-13076885 CAGGAACAGCAGATTCCATGAGG - Intronic
1094756971 12:33482338-33482360 CAGGAAGAGCAGAAATAGGGAGG + Intergenic
1096028146 12:48386230-48386252 CAGGAACAGCACAAAGAGTGGGG + Intergenic
1096258005 12:50074439-50074461 CAGGAAAAGCAGCACTGGTGTGG - Intronic
1098199544 12:68040170-68040192 CATGGAGAGCAGAACTGGTGGGG + Intergenic
1099007892 12:77256703-77256725 GAGGAACAGCAGAAATCTTCAGG + Intergenic
1102895959 12:116598834-116598856 AAGGAACAGCAGAACTCTAAAGG - Intergenic
1107203092 13:37746301-37746323 CAGTTACAGCGGACCTCGTGGGG + Exonic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109928432 13:69180084-69180106 CAGGAAAAGCAGAAATCGTGGGG - Intergenic
1111833766 13:93361758-93361780 CAGGAACAGCAGTAGTGGTTAGG + Intronic
1112177261 13:97038253-97038275 CAGGAACAGGAAAACTCCTGTGG - Intergenic
1114835444 14:26198037-26198059 CAGGAAAAGCAGACATAGTGAGG + Intergenic
1116032755 14:39592329-39592351 CAGAGACAGCAGAACAGGTGCGG + Intergenic
1116523796 14:45880406-45880428 CAGGGACAGCTGAACTCCTGGGG + Intergenic
1122038489 14:98965196-98965218 CAGCAACAGCAGGTCTCCTGTGG - Intergenic
1129446287 15:75620888-75620910 CTGGAACTGCAGAAATCGTAAGG - Exonic
1131355608 15:91743149-91743171 GAGGAGCAGCAGAGCTCGAGGGG - Intergenic
1133167412 16:3957992-3958014 CAGAAACAGCAGCTCTCGGGAGG + Intronic
1140461745 16:75145689-75145711 CAGGGACAGCAGAACTCCAGGGG + Intergenic
1141508659 16:84498062-84498084 GGGGAACAGCAGAAGCCGTGTGG - Exonic
1142150581 16:88510887-88510909 CAGGCCCAGCAGGACTTGTGAGG - Intronic
1143728887 17:8868714-8868736 CAGGAACAGTAGACCTGCTGGGG + Intergenic
1145933080 17:28699890-28699912 CAGGAAGAGCAGAACTCACCTGG - Exonic
1150329644 17:64284582-64284604 CAGGATCAGCAGGAATGGTGTGG - Intergenic
1150952393 17:69818235-69818257 CAGAAACATCAGAAATCCTGAGG + Intergenic
1152202293 17:78954181-78954203 CAGTCACAGCAGACCCCGTGCGG - Intergenic
1156420522 18:36947705-36947727 CAGGAACAGAAGAACTGGAAAGG + Intronic
1157619536 18:49008409-49008431 CAGGTCCAGGAGGACTCGTGTGG + Intergenic
1160397087 18:78580434-78580456 CAGGCGCAGAAGAACACGTGGGG + Intergenic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
928402128 2:30986666-30986688 TATGAACAGCAGAACTCCTCTGG + Intronic
933374700 2:81464624-81464646 TAGGATCAGCAGAACTAGTAAGG - Intergenic
934014260 2:87862306-87862328 CAGGCACAGCATCATTCGTGGGG - Intergenic
937856927 2:126678887-126678909 CAGGAGCAGCAGAGCCCGTGTGG - Intronic
939340979 2:140895773-140895795 CTGGGACAGCAGAACTCCAGGGG - Intronic
946974503 2:225133221-225133243 CAGAACCAGCAGACCTCCTGTGG + Intergenic
1173988448 20:47280895-47280917 CAGGAAGAGCAGAGGTCGGGAGG - Intronic
1177918070 21:27115607-27115629 CAGTAACAGCAGGACTCTGGGGG + Intergenic
1181053401 22:20248113-20248135 GAGGAACATAAGAACTGGTGTGG + Intronic
1184521954 22:44999863-44999885 CAGGAACACCAGGACGCGTCAGG + Intronic
954328038 3:49874292-49874314 CTGCAGCAGCTGAACTCGTGAGG + Intergenic
960395401 3:117131130-117131152 CAGGGACAGCCGAACTCCAGGGG + Intronic
969661569 4:8532656-8532678 CAGGAACATCAGCACTGGGGTGG + Intergenic
974675717 4:65086218-65086240 CAGAATCATCAGATCTCGTGAGG + Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981633489 4:146848809-146848831 CAGGAACAGGAGCAGTCCTGGGG - Intronic
985889397 5:2704167-2704189 CCCAAACAGCTGAACTCGTGCGG - Intergenic
986659565 5:10046819-10046841 CAGGAACAGCTGAACACGACGGG - Intergenic
991604148 5:68383539-68383561 CAACAACAACAGAACTTGTGGGG + Intergenic
996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG + Intergenic
997574789 5:134966352-134966374 CAGGGACAGCAGAGATGGTGGGG + Exonic
1000502504 5:162068684-162068706 CAGGGACAGCAGTCCTGGTGAGG + Intronic
1002279124 5:178120586-178120608 GAGGAGCAGGAGAACTCGTAGGG - Exonic
1002828526 6:796213-796235 CAGGATTATCAGAACTCATGTGG - Intergenic
1003280000 6:4682969-4682991 CAGGAACAGGAGCATGCGTGGGG - Intergenic
1003962173 6:11219053-11219075 CAGGAACAGCAGAACCCAAGTGG - Intronic
1004999080 6:21222781-21222803 CAGGGACAGAAGAACTCATTTGG + Intronic
1006438796 6:34040763-34040785 CAGGAACAGGGACACTCGTGAGG + Intronic
1007679800 6:43626189-43626211 CAGGTAAAGGAGAACTGGTGGGG + Intronic
1008754209 6:54774360-54774382 CAGGAACTGCAGAGCTTATGAGG + Intergenic
1013797880 6:113906395-113906417 CAGGGACAGCAGGCCTCATGTGG + Intergenic
1014279846 6:119429622-119429644 AAGAAGCAGCAGAAGTCGTGAGG + Intergenic
1015016895 6:128424538-128424560 GAAGAACAGCAGAAGTCATGAGG + Intronic
1019755213 7:2763754-2763776 CAGGAAAAGCAGAGCCTGTGGGG - Intronic
1019758669 7:2792326-2792348 CAGGCACAGCATAACTGGTACGG + Intronic
1020563690 7:9768767-9768789 CAGGAAAAGAAGAAATGGTGGGG + Intergenic
1021142673 7:17046858-17046880 CAGCAAAAGGAGAACTCTTGCGG + Intergenic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1023786251 7:43711107-43711129 CAGTGACAGCAGAAATCTTGTGG + Intronic
1024306947 7:47937391-47937413 CAGGAGCAGCAGAAGTCTCGTGG + Intronic
1025135408 7:56407594-56407616 GAGGAAAAGCAGACCTCTTGGGG + Intergenic
1027052014 7:75026484-75026506 CAGAAACAGCACAACTCGGCTGG - Intergenic
1027255402 7:76427645-76427667 CAGAACCAGCATAGCTCGTGGGG - Intronic
1036644170 8:10601699-10601721 CAGGAACAGCAGAGCACGGATGG + Intergenic
1037210006 8:16375317-16375339 CAGGAACAGCCAAGCTAGTGGGG + Intronic
1039290447 8:36088907-36088929 CAGGGACAGCTGAACTCCAGGGG - Intergenic
1041346313 8:56902129-56902151 CAGCAACAGCAGAGCTCCTAGGG + Intergenic
1042529569 8:69801052-69801074 CAGGAACAGCAGAATTCCTTAGG + Intronic
1042704850 8:71655242-71655264 CAAGAACAGCAGAACTGGCTGGG - Intergenic
1043618857 8:82162661-82162683 CAGCAGCAGCAGAACTTGTCAGG - Intergenic
1043967210 8:86492709-86492731 CAGGAACTGAAGCACTCCTGTGG - Intronic
1047113784 8:121818484-121818506 CAGGGACAGCCGAACTCTAGGGG + Intergenic
1054855289 9:69892830-69892852 CAGGGACAGCCGAACTCCAGGGG + Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1190233418 X:48599177-48599199 CAGGAACAGCAGAACTCGTGAGG + Intronic
1195092052 X:101470022-101470044 CAGCAGCAGCAGAACACTTGCGG - Intronic
1195239188 X:102934282-102934304 TAGGAACAGCAGACCCCTTGGGG + Intergenic
1196874448 X:120144638-120144660 CAGGAGCAGGAGAACTTGGGAGG + Intergenic
1199130213 X:144176167-144176189 CAGGCACAGCATCATTCGTGGGG + Intergenic
1199357617 X:146880163-146880185 CATCAACAGCAGAAATCGTCAGG + Intergenic
1199863141 X:151820056-151820078 GAGGAAGAGCAGAAGTCGTAGGG + Intergenic