ID: 1190233776

View in Genome Browser
Species Human (GRCh38)
Location X:48601085-48601107
Sequence GGCATTCCCCTTTTTATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190233776_1190233783 -5 Left 1190233776 X:48601085-48601107 CCCCCCATAAAAAGGGGAATGCC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1190233783 X:48601103-48601125 ATGCCGTTCTTGATCTGGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 69
1190233776_1190233789 25 Left 1190233776 X:48601085-48601107 CCCCCCATAAAAAGGGGAATGCC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1190233789 X:48601133-48601155 GTGGTACACTCCAGGGAGCACGG 0: 1
1: 0
2: 0
3: 12
4: 148
1190233776_1190233788 18 Left 1190233776 X:48601085-48601107 CCCCCCATAAAAAGGGGAATGCC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1190233788 X:48601126-48601148 CCTTGCTGTGGTACACTCCAGGG 0: 1
1: 0
2: 3
3: 15
4: 151
1190233776_1190233785 6 Left 1190233776 X:48601085-48601107 CCCCCCATAAAAAGGGGAATGCC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1190233785 X:48601114-48601136 GATCTGGGTTGGCCTTGCTGTGG 0: 1
1: 0
2: 4
3: 12
4: 200
1190233776_1190233781 -10 Left 1190233776 X:48601085-48601107 CCCCCCATAAAAAGGGGAATGCC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1190233781 X:48601098-48601120 GGGGAATGCCGTTCTTGATCTGG 0: 1
1: 0
2: 1
3: 3
4: 34
1190233776_1190233782 -9 Left 1190233776 X:48601085-48601107 CCCCCCATAAAAAGGGGAATGCC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1190233782 X:48601099-48601121 GGGAATGCCGTTCTTGATCTGGG 0: 1
1: 0
2: 0
3: 3
4: 119
1190233776_1190233786 17 Left 1190233776 X:48601085-48601107 CCCCCCATAAAAAGGGGAATGCC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1190233786 X:48601125-48601147 GCCTTGCTGTGGTACACTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1190233776_1190233790 26 Left 1190233776 X:48601085-48601107 CCCCCCATAAAAAGGGGAATGCC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1190233790 X:48601134-48601156 TGGTACACTCCAGGGAGCACGGG 0: 1
1: 0
2: 1
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190233776 Original CRISPR GGCATTCCCCTTTTTATGGG GGG (reversed) Intronic
900931432 1:5740361-5740383 GGTATTCCCTTTCTCATGGGCGG - Intergenic
901285467 1:8075259-8075281 TGCATTCTTCTTTTTTTGGGTGG + Intergenic
906079991 1:43079922-43079944 GGCATTTCTCTTTTTTTGGCAGG - Intergenic
912624384 1:111195490-111195512 AGCATTCCCCTGTGCATGGGTGG + Intronic
912853776 1:113149308-113149330 GGCAGCCCTCTTTTTTTGGGGGG + Intergenic
914383506 1:147143512-147143534 GGCATTTCTTTTTTTTTGGGAGG + Intergenic
914928283 1:151907720-151907742 GGCATTCCTCTTCTTTTTGGGGG + Intronic
916272755 1:162961558-162961580 GGCATGTCCTTTTTTATGGGGGG - Intergenic
916830143 1:168482454-168482476 AGCCTCCTCCTTTTTATGGGAGG + Intergenic
920084143 1:203402346-203402368 GACTTTCTGCTTTTTATGGGTGG - Intergenic
922721116 1:227900739-227900761 GGCATTCCCGTGTCCATGGGGGG + Intergenic
922928708 1:229372444-229372466 GGCATGTCCTCTTTTATGGGAGG + Intergenic
923365622 1:233258278-233258300 GGCATGCCTCTTTTCATGGCTGG + Exonic
923491707 1:234489915-234489937 GGAATTCCCCTTTGCTTGGGAGG - Intergenic
1063950554 10:11218633-11218655 GGTATTCCCCTTTGTATGCGAGG + Intronic
1065545539 10:26816522-26816544 GTCATTCTCCTTTCTCTGGGTGG - Intronic
1065759792 10:28971494-28971516 GGCACTGCCCTTTTTAGGGGAGG + Intergenic
1065839229 10:29687123-29687145 GGCATGTCCTTGTTTATGGGAGG - Intronic
1070661231 10:78306801-78306823 GGCCTCCCCCTTTTACTGGGAGG + Intergenic
1075088861 10:119431624-119431646 GGCATTCCCCTTCCCAGGGGTGG - Intronic
1075905770 10:126080757-126080779 GGCATTCCTCTTTTTAAAAGTGG - Intronic
1076918004 10:133434190-133434212 AGCATTCCCATTCTTACGGGTGG - Intergenic
1076938002 10:133578267-133578289 AGCATTCCCATTCTTACGGGTGG - Intergenic
1077878604 11:6328882-6328904 GACATTCCCCTTTGTATCTGGGG + Intergenic
1078230271 11:9434802-9434824 AACATTCACCTTTTTTTGGGGGG - Intronic
1082793320 11:57362441-57362463 GCCATTCCCCTTTTTAGATGAGG + Intronic
1084542782 11:69797779-69797801 GGCACCGCCCATTTTATGGGAGG + Intergenic
1088442996 11:109892317-109892339 GGCATTCCACTTCTTATGGTTGG - Intergenic
1088588099 11:111377748-111377770 GGCATTCATCTTTTTACTGGGGG - Intronic
1088700673 11:112408465-112408487 GTCCTTCCCCATTTTATGGCAGG + Intergenic
1088748026 11:112820781-112820803 GGGATTCTCATTTTTATGGCTGG - Intergenic
1092287046 12:7134664-7134686 GCCATTTCCCTTCTTATGGCTGG + Intronic
1094361978 12:29640436-29640458 GGCATTCACAGTTTTGTGGGGGG - Intronic
1095076526 12:37934849-37934871 GGCATTTCCCTTTTTATCATAGG + Intergenic
1096928254 12:55173355-55173377 GGCATTTTCCTTCTTTTGGGGGG + Intergenic
1101862888 12:108497457-108497479 GACATTTCCCTTTATATGGCTGG - Intergenic
1104651268 12:130536100-130536122 TTTATTCCCCATTTTATGGGTGG + Intronic
1105568158 13:21572594-21572616 GGCATGTCCTTGTTTATGGGAGG + Intronic
1105789500 13:23784047-23784069 GGCATTACCCTATTTATAGATGG - Intronic
1106201501 13:27541360-27541382 GCAATTTGCCTTTTTATGGGAGG - Intergenic
1114744241 14:25130099-25130121 ATCATTCCCCTTGTTATGAGTGG - Intergenic
1119031777 14:71198281-71198303 GGCATGTCCTTATTTATGGGAGG - Intergenic
1121163427 14:91768021-91768043 GTCTTTCCCCTTTTTGTAGGGGG - Intronic
1121838846 14:97116211-97116233 GCCATGCCCCATTTTCTGGGTGG + Intergenic
1124002596 15:25771250-25771272 GGCATGTCCTTGTTTATGGGTGG - Intronic
1124632185 15:31344275-31344297 GGCTTTCCCCTCTTTGTGGCAGG + Intronic
1127737958 15:61863036-61863058 AGCATACCCCTTTTAAAGGGTGG - Intronic
1129666580 15:77582696-77582718 GTCACTGCCCCTTTTATGGGCGG - Intergenic
1130216881 15:81980055-81980077 AACATTCCCCTTTTTAAGTGTGG - Intergenic
1133995642 16:10745953-10745975 GGCATGTCCTTGTTTATGGGAGG + Intronic
1136674146 16:31884791-31884813 GACATTCGCCTTTTTATTTGAGG + Intronic
1141674627 16:85511195-85511217 GGCTTTTCCCTTTCTATGTGTGG + Intergenic
1142582717 17:952049-952071 GGCGTTTCCGTTTTTGTGGGGGG + Intronic
1147020457 17:37527815-37527837 GTCATTCCCCTGTCCATGGGGGG - Intronic
1150867130 17:68864486-68864508 GCCATTACTCTTTTTTTGGGGGG + Intergenic
1151148575 17:72064376-72064398 GGCATTGGCGTTTTTGTGGGAGG + Intergenic
1152083277 17:78202031-78202053 GGCAGTCCTCTTTCGATGGGAGG + Intronic
1153148163 18:2057140-2057162 GGCATGTCCTTGTTTATGGGAGG + Intergenic
1153854142 18:9128518-9128540 GGTATACCCCTTTTTTTAGGAGG + Intronic
1156104675 18:33645564-33645586 GGCATTCCCATTTTTATCTAGGG + Intronic
1157687126 18:49651385-49651407 AGCATTGCCCTTTCTGTGGGAGG + Intergenic
1159533419 18:69684631-69684653 GCCTTTCCTCTTTTCATGGGAGG + Intronic
1159752466 18:72319509-72319531 GACATTCTCCTTATGATGGGTGG - Intergenic
1162448258 19:10737811-10737833 GGCATTCCCCTTCTAGTGGGGGG - Intronic
1166241093 19:41494353-41494375 GGCATTTTCCTTTTTATTAGAGG + Intergenic
1167675169 19:50879452-50879474 GGCCTTTCCCTTTGGATGGGGGG + Exonic
925604702 2:5647241-5647263 GGTATTCCCCTTGCCATGGGAGG - Intergenic
931845409 2:66199041-66199063 AACATTCCCCTTTTTATGCCTGG + Intergenic
932159987 2:69450928-69450950 GGCATGTCCTTGTTTATGGGAGG - Intergenic
934480946 2:94643621-94643643 ATCACACCCCTTTTTATGGGAGG - Intergenic
935261552 2:101359908-101359930 GGCATGTCCTTGTTTATGGGAGG - Intronic
935548238 2:104423529-104423551 GGCAATCCCCTTTTCAAGGGAGG - Intergenic
936373139 2:111919619-111919641 GGCATTTGCCTTTTTCTTGGTGG - Intronic
938221823 2:129575416-129575438 GACATTCCCCTAGTTTTGGGGGG + Intergenic
941013277 2:160325583-160325605 GGAAATCCCCTTTGTCTGGGAGG - Intronic
941284130 2:163587814-163587836 GGTTTTCCCCAATTTATGGGAGG - Intergenic
944544816 2:200788775-200788797 GGCATTCCTCAGTTTAAGGGAGG + Intergenic
948983313 2:241506006-241506028 GTCATTCCCCTTGTTTTGTGGGG - Intronic
1179264118 21:39787203-39787225 GGCATTCCCCTGTTGCTGGAGGG + Intronic
1179616234 21:42585115-42585137 GGCATGTCCTTGTTTATGGGAGG + Intergenic
953547762 3:43876239-43876261 AGAATTCCCCTTCTGATGGGAGG + Intergenic
953663161 3:44905755-44905777 GGCATTGCCCTTATAATAGGGGG + Intronic
954874111 3:53789900-53789922 GCCATTCCCCTTCATGTGGGAGG - Intronic
965056343 3:163721858-163721880 GGCATTCCCCTTTTCCTGACCGG - Intergenic
965278811 3:166722381-166722403 GGCATTTCCCTCTTTTTGGGGGG - Intergenic
965897498 3:173595208-173595230 GGCATTCCGTTTTTCAAGGGAGG - Intronic
966437772 3:179907867-179907889 GGCTTTCCCCATTTTCTGGCAGG + Intronic
967551855 3:190805086-190805108 GGCATTCCACTGCTTATGGTGGG + Intergenic
971794911 4:31215101-31215123 GGCCTCCACCTTCTTATGGGAGG - Intergenic
975846014 4:78525867-78525889 GGGACTTCCCTGTTTATGGGGGG - Intronic
975965054 4:79963178-79963200 GGCCTTGCCCTTTTTAATGGTGG - Intronic
978757203 4:112315261-112315283 GGGATTCCCATTTTTCTGGCAGG + Intronic
980407618 4:132373948-132373970 CCCATTCCCCTTTCAATGGGAGG - Intergenic
985421323 4:189787944-189787966 TGCCTCCCCCTTTTTTTGGGCGG - Intergenic
987677084 5:21088764-21088786 AGTATGCCCTTTTTTATGGGAGG + Intergenic
989262670 5:39435896-39435918 GGCATTCTCCTTATTAGAGGAGG - Intronic
989387852 5:40871231-40871253 GGCGTTTCCTTGTTTATGGGAGG + Intergenic
995582238 5:113614307-113614329 GGCATGTCCTTGTTTATGGGAGG + Intergenic
998744034 5:145236494-145236516 GGCATGTCCTTGTTTATGGGAGG - Intergenic
999878884 5:155839323-155839345 GGCATGTCCTTGTTTATGGGAGG + Intergenic
1000172668 5:158718403-158718425 TGCCTTCCCCTTTTTTTGGAGGG + Intronic
1004073879 6:12327681-12327703 GGCATGACCTTGTTTATGGGAGG - Intergenic
1005751446 6:28886564-28886586 GGCATGTTCATTTTTATGGGTGG - Intergenic
1007465004 6:42045677-42045699 GGCCTGCCCCTTTCTAGGGGTGG - Intronic
1015346859 6:132170683-132170705 GGTGTTCCCATTTTTTTGGGTGG - Intergenic
1018905340 6:168072455-168072477 GGCATCCCCCTCCCTATGGGAGG - Intronic
1019258547 7:66927-66949 GGCATTTCTCTTTTCCTGGGAGG + Intergenic
1019832913 7:3350852-3350874 GTCATTCTACTTTTAATGGGGGG - Intronic
1021018594 7:15567295-15567317 GGGATTCCCTTTTTTTTGGGGGG + Intergenic
1021439756 7:20664545-20664567 GGCATTTTCCTTATTTTGGGAGG - Intronic
1024520081 7:50297936-50297958 CCCTTTCCCCTGTTTATGGGTGG - Intergenic
1032595846 7:133239007-133239029 AGCAATCCTCTTTTTTTGGGGGG - Intergenic
1033987838 7:147248346-147248368 GGGATTCCCTTTTTTGTGTGTGG + Intronic
1039125085 8:34192081-34192103 GACTTTTCCCTTTTCATGGGGGG + Intergenic
1040846389 8:51846364-51846386 TTCATTCCCCTTTTCCTGGGAGG - Intronic
1040992175 8:53364151-53364173 GGCATTAACCTGTGTATGGGTGG + Intergenic
1041184705 8:55286805-55286827 CACATTCCCCATTTGATGGGAGG - Intronic
1041908838 8:63066368-63066390 GGCATTCCCATCTTTATGTGAGG - Intronic
1044274013 8:90279184-90279206 GGCATGCCCTTATTTATGTGGGG - Intergenic
1047155804 8:122316689-122316711 GGCACTCCCCTTATTATTGATGG - Intergenic
1054286826 9:63184559-63184581 ATCACACCCCTTTTTATGGGAGG - Intergenic
1054387991 9:64580415-64580437 ATCACACCCCTTTTTATGGGAGG + Intergenic
1055759027 9:79586933-79586955 AGCATTTCCCTTTTTTTGTGTGG + Intronic
1056672074 9:88638880-88638902 GGCATGTCCTTGTTTATGGGAGG - Intergenic
1057066390 9:92056113-92056135 GGGTTGCCCCTTTTTTTGGGAGG - Intronic
1058394040 9:104529069-104529091 GGCATTCCCTTTTGTATGTAAGG + Intergenic
1188212811 X:27444140-27444162 GGCATTTCCTTCTTTTTGGGGGG - Intergenic
1190233776 X:48601085-48601107 GGCATTCCCCTTTTTATGGGGGG - Intronic
1196321647 X:114347743-114347765 TGCATTTCCCTTATTATGTGTGG - Intergenic
1198735554 X:139781086-139781108 GGCGTTCCTCTTTTTTTGGAGGG - Intronic
1199182888 X:144879065-144879087 GGCATTCCCCTCCCTCTGGGAGG - Intergenic
1199389340 X:147261784-147261806 GGCATTCCATTTTATAAGGGAGG + Intergenic
1199868103 X:151872476-151872498 AGAATTCCCCATTTTAAGGGTGG - Intergenic
1200173171 X:154094117-154094139 GTCATTCCCCCTTTGATGTGGGG + Intronic