ID: 1190242559

View in Genome Browser
Species Human (GRCh38)
Location X:48668728-48668750
Sequence GGACTCCTTCCCTGACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190242559_1190242563 -9 Left 1190242559 X:48668728-48668750 CCAGGGTGTCAGGGAAGGAGTCC No data
Right 1190242563 X:48668742-48668764 AAGGAGTCCTGGGGAAAGTGAGG No data
1190242559_1190242565 11 Left 1190242559 X:48668728-48668750 CCAGGGTGTCAGGGAAGGAGTCC No data
Right 1190242565 X:48668762-48668784 AGGTCTCAGCTAACATCTGAAGG No data
1190242559_1190242566 20 Left 1190242559 X:48668728-48668750 CCAGGGTGTCAGGGAAGGAGTCC No data
Right 1190242566 X:48668771-48668793 CTAACATCTGAAGGCTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190242559 Original CRISPR GGACTCCTTCCCTGACACCC TGG (reversed) Intergenic
No off target data available for this crispr