ID: 1190246899

View in Genome Browser
Species Human (GRCh38)
Location X:48696816-48696838
Sequence AGGCAGAGGCGCGGGCCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 278}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190246892_1190246899 20 Left 1190246892 X:48696773-48696795 CCGTGGGGAAAGATGGCGGAAAA 0: 1
1: 0
2: 4
3: 48
4: 367
Right 1190246899 X:48696816-48696838 AGGCAGAGGCGCGGGCCCGCTGG 0: 1
1: 0
2: 1
3: 25
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190246899 Original CRISPR AGGCAGAGGCGCGGGCCCGC TGG Intronic
900095066 1:936890-936912 AGGCACAGGGGAGGGCCTGCTGG - Intronic
900164155 1:1238028-1238050 AGGGAGAGGCCCGGGCGTGCGGG + Intergenic
900620927 1:3587549-3587571 AGTCAGAGCCGCAGGCACGCAGG - Intronic
900623700 1:3598728-3598750 AGGCAGAGGAGTGGGCCCCGGGG - Intronic
900978963 1:6035480-6035502 AGGGAGAGGCACGGGGCCCCTGG + Intronic
901052759 1:6433720-6433742 AGGCAGGGGCGCTGGCCTGTTGG - Intronic
901212451 1:7534274-7534296 AGGCCGAGGCTGGGGGCCGCGGG + Intronic
901506641 1:9689600-9689622 GGGCAGCGGCGCGGGGCCGGCGG - Intronic
901597852 1:10399294-10399316 GGGCAGGGGGCCGGGCCCGCAGG - Intronic
901790149 1:11649712-11649734 AGGCAGAGGGGAGAGCCAGCTGG - Intronic
902765528 1:18612256-18612278 AGGCAGAGAAGCGGCTCCGCTGG + Intergenic
903555036 1:24187170-24187192 AGGTAAGGGCGCGGGGCCGCGGG - Exonic
903806489 1:26009376-26009398 GGGCAGAGGCGAGGGCCTGGAGG + Intergenic
904215328 1:28914515-28914537 GGGGAGGGGCGCGGGCCGGCGGG + Intronic
905505580 1:38476574-38476596 GGGCAGGGGCGCGGGCCGGGGGG - Intergenic
907051030 1:51330227-51330249 AGGCGGAGGCGCGGGGACCCCGG - Intronic
907160949 1:52368578-52368600 AGGCAGCGGCGCGGGCCCCGGGG - Intergenic
907486868 1:54784138-54784160 AGGCAGAGGCCCAGGCCAGTAGG + Intronic
908520045 1:64932786-64932808 AGGCAGAGGCAGGTGCCAGCTGG - Intronic
908800498 1:67875270-67875292 AGGCAGAGGCACAGGCTTGCTGG + Intergenic
912927892 1:113929684-113929706 AGGCCGAGGCGGGAGCGCGCGGG + Intronic
913256424 1:116958248-116958270 AGGCTGAGGCGAGGGCCTGCAGG + Intronic
915517441 1:156421482-156421504 TGGCGGACGCGCGGGCACGCCGG + Intronic
919774240 1:201183860-201183882 AGGCAGCGGCTGGGGCCTGCTGG - Intergenic
920076699 1:203342371-203342393 AGGCAGAGGGGCGCGTCGGCAGG + Exonic
922793135 1:228321612-228321634 AGGCAGATGTGCGAGCCCGCTGG + Exonic
1066126464 10:32347199-32347221 GCGCAGCGGCGCGGGCACGCGGG + Intronic
1070022935 10:72604558-72604580 AGGCAGAAGGCCGGGCACGCTGG - Intronic
1070032787 10:72692797-72692819 AGGACGAGGGGCGGCCCCGCCGG - Intronic
1070290254 10:75109161-75109183 AGGCAGAGGGGTGGGCGGGCTGG - Exonic
1072435904 10:95414616-95414638 AGCCAGAGGCGCGGGCTGGCTGG + Exonic
1072783949 10:98268102-98268124 AGGCAGACGCGCGGCCAGGCGGG + Intronic
1075737199 10:124671255-124671277 AGGCAGGGGCGCCGGCTAGCTGG - Intronic
1076694114 10:132238889-132238911 ACACAGAGGAGCGGGCACGCTGG + Intronic
1078084236 11:8224252-8224274 AGGCAGAGGGGAGGGGCCCCAGG + Intergenic
1080749473 11:35139179-35139201 TGGCAGAGGCTGGGGTCCGCTGG - Exonic
1081115366 11:39192918-39192940 AGGGAGAGGCACGGGCGGGCGGG - Intergenic
1082028347 11:47588292-47588314 AGGCTGAGGAACGGGGCCGCTGG + Exonic
1083227554 11:61294562-61294584 GGGCAGAGCCACGGGCACGCTGG + Intronic
1083270051 11:61567679-61567701 AGGCAGTGCGGCGGGCCCCCGGG - Intronic
1083572764 11:63768980-63769002 AGGCGGCGGTGCGGGCCCGCGGG - Intergenic
1083631450 11:64097511-64097533 TGGCAAAGGCCCAGGCCCGCCGG + Intronic
1084270994 11:68029124-68029146 AGGAAGAGGAGGTGGCCCGCAGG - Exonic
1084323973 11:68388474-68388496 AGGCAGAGGGGCTGGCCGGCTGG + Intronic
1084446859 11:69208883-69208905 AGGCAGAGGCGTGTCCCAGCAGG - Intergenic
1084733815 11:71091735-71091757 GGGCTGAGGAGGGGGCCCGCAGG - Intronic
1084793604 11:71490211-71490233 AGGCAGAGACGCGAGGCCGCTGG - Intronic
1085322885 11:75585438-75585460 AGGCTGAGCCCCAGGCCCGCTGG + Intergenic
1090800951 11:130171737-130171759 AGGCAGAGCCTCGGGCACACAGG + Intronic
1095436902 12:42199171-42199193 AGGCAGAGGCTTGAGCCAGCAGG + Intronic
1095944399 12:47745889-47745911 AAGCGGAGGTGGGGGCCCGCAGG + Intronic
1096491422 12:52015034-52015056 GGGCGGAGGCGGGGGCGCGCCGG + Exonic
1100632008 12:96399522-96399544 AGGAAGGGGCGCGGGTCCGCGGG - Intronic
1103052523 12:117792628-117792650 AGGCAGAGGGCAGGGGCCGCGGG - Intronic
1103363981 12:120369244-120369266 CGGCCGAGGGGAGGGCCCGCCGG + Intergenic
1103595392 12:122022050-122022072 AGGCTGGGGAGCGCGCCCGCCGG - Exonic
1104809256 12:131610727-131610749 AGGCAGAGGAGCTGGCAAGCGGG - Intergenic
1105847772 13:24308169-24308191 AGGCAGAGGTCCAGGCCGGCAGG + Intronic
1106516918 13:30464570-30464592 CGGCGGCGGCGCGGGCCTGCAGG - Intronic
1107055751 13:36101652-36101674 AGGCAGAGATGCGGACCCTCAGG - Intronic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113271771 13:108682462-108682484 AGTCAGAGCCGCGGGCACACAGG + Intronic
1113859710 13:113473221-113473243 AGGCAGAGGCACGGGGCAGAAGG - Intronic
1113861499 13:113490473-113490495 CGTCGGAGGCGCGGGACCGCGGG - Intronic
1115399137 14:32938808-32938830 AGGCGGCCGCGCGGTCCCGCGGG - Intronic
1117381891 14:55172694-55172716 AGGCAGAGGGTCGGGCACGGTGG + Intronic
1117699158 14:58396107-58396129 AGGCGGAGGCGCGGCCGGGCCGG + Intronic
1117742589 14:58833927-58833949 AGGGAGAGGCGCGGGCAGGAAGG + Intergenic
1119744443 14:77033978-77034000 AGGCCCAGGCGCGCGCCCGGCGG - Intergenic
1119756745 14:77125118-77125140 CGGCCGTGGCTCGGGCCCGCCGG - Intronic
1121293222 14:92794460-92794482 AGGCGGAGGCGAGGGCCCACTGG + Intronic
1122799775 14:104223727-104223749 TGGCACAGACGCGGGCCCACGGG - Intergenic
1123039115 14:105483199-105483221 AGGCAGGGGTGCAGCCCCGCTGG + Intergenic
1126485125 15:49171367-49171389 AGGCAGAGGGCCGGGCGCGATGG - Intronic
1127281570 15:57497689-57497711 AGGCAGAGGGGCAGGCCCTGCGG + Intronic
1128780690 15:70356994-70357016 AGTCAGAGGCCAGGGCCTGCAGG - Intergenic
1129110656 15:73335262-73335284 AGGCACAGACGGGGGCCCGTGGG + Intronic
1129540407 15:76343069-76343091 AGACAGAGGCGGGGGCCGGGCGG + Intergenic
1132381854 15:101371685-101371707 AGGCAGAGGCGTGGGCTCTGGGG - Intronic
1132570625 16:642417-642439 AGTGCGAGGCGCAGGCCCGCGGG - Intronic
1132796317 16:1725039-1725061 AGGCAGGAGGGTGGGCCCGCTGG + Intronic
1132881519 16:2163676-2163698 ATGCAGAGGCCCGGGCAGGCAGG - Intronic
1135382756 16:22008196-22008218 AGGCAGCGGCGCGGGGACTCCGG + Exonic
1136287214 16:29251615-29251637 AGGGACAGGCCCGGGCACGCAGG - Intergenic
1136478411 16:30526843-30526865 AGGCCGCGGCGCGAGCCGGCGGG - Intronic
1137300388 16:47143500-47143522 ACGCAGAGGCGCGGGCAGGGCGG + Intronic
1139548678 16:67661636-67661658 GCGCAGTGGCGGGGGCCCGCTGG - Exonic
1139683386 16:68582738-68582760 AGGCGGAGGCGGTGCCCCGCTGG + Intergenic
1141132166 16:81444419-81444441 TGGGTGAGGCGCGGGCCCCCAGG + Intergenic
1141736833 16:85859718-85859740 CGGCAGGGCCGCGGGGCCGCTGG + Intergenic
1142092825 16:88224248-88224270 AGGGACAGGCCCGGGCACGCAGG - Intergenic
1142197126 16:88744132-88744154 AGGCGGGGGCGCGGGGCCCCTGG - Intronic
1142513154 17:410519-410541 GGGCGGCGCCGCGGGCCCGCGGG + Exonic
1143223744 17:5282642-5282664 GGGCGGAGGCGGGGGCGCGCGGG + Intronic
1143390510 17:6556672-6556694 GGGCGGGGGTGCGGGCCCGCGGG - Intergenic
1143473968 17:7192580-7192602 AGGCAGGGGAGAGGGCCAGCGGG + Intronic
1144944648 17:18963716-18963738 AGGCAGGGGCACTGGCCCACAGG + Intronic
1144968175 17:19090738-19090760 AGGCAGAGTCGCTGGTCCTCAGG - Intergenic
1144979742 17:19161325-19161347 AGGCAGAGTCGCTGGTCCTCAGG + Intergenic
1144988480 17:19216907-19216929 AGGCAGAGTCGCTGGTCCTCAGG - Intronic
1145037798 17:19553332-19553354 AGGCAGAGGAGCAGGCTCGTGGG - Intronic
1146647067 17:34582578-34582600 AGGCAGAGCAGCGAGCCAGCAGG + Intronic
1147000585 17:37359284-37359306 GGGGCGAGGCGCGGGCCCGAGGG + Intronic
1151032047 17:70752637-70752659 AGGCAGTGGCGCGGGCCTGTTGG + Intergenic
1152037636 17:77883238-77883260 AGGCAGAGGCCCAGGCAGGCGGG + Intergenic
1152070554 17:78131880-78131902 AGGCAGCTGCGGGAGCCCGCGGG + Exonic
1152127975 17:78458848-78458870 AGGCAGAGGCAGGGGCCAGATGG - Intronic
1152175157 17:78782341-78782363 AGGCGCAGGCGCGGGCGGGCGGG - Intergenic
1152363618 17:79843416-79843438 ATGCGGAGGCGCGGCCCTGCGGG - Intergenic
1152544120 17:80992204-80992226 AGGCGGACGCGCGGGCCCCGGGG - Intronic
1152635618 17:81429460-81429482 CGGCAGAGGCCAGGGCCGGCGGG + Intronic
1154070841 18:11149806-11149828 ACGCAGAGCCGCGGGGCTGCGGG - Intergenic
1158534622 18:58296549-58296571 CGGCAGAGGCTGGAGCCCGCTGG - Intronic
1160369876 18:78363201-78363223 GGGCAGAAGGCCGGGCCCGCAGG + Intergenic
1160678309 19:401962-401984 AGGCTCAGGCGCCGGCCCGCGGG + Intergenic
1160730534 19:639869-639891 AGGCAGAGCCGCGGACGCCCGGG + Intronic
1160923928 19:1533958-1533980 AGGCAGAGGCCGGGTCCAGCAGG - Exonic
1160933003 19:1579421-1579443 AGGCAGAGGAGCGGCCACCCTGG - Intronic
1161000666 19:1909265-1909287 AGCCAGAGGCGCTGTCCCCCAGG + Intronic
1161010022 19:1955477-1955499 AGGCTGAGGCGAGGCTCCGCGGG + Intronic
1161072389 19:2269416-2269438 GGGCAGAGCCGCGGGGCCGCCGG - Intronic
1161283213 19:3456675-3456697 GGGCAGAGGGGCCGGCCCGGGGG + Intronic
1161284688 19:3463267-3463289 CGGCAGAGGCGCGGGGGCCCGGG - Intronic
1161334996 19:3708333-3708355 AGGGTGAGGGGCGGGCCAGCAGG - Intronic
1161583427 19:5092750-5092772 AGTCAGAGGAGGGGGCTCGCAGG + Intronic
1162145302 19:8609518-8609540 AGGCAGAGGCCCCAGCCTGCCGG + Intronic
1163323249 19:16586776-16586798 GGGCACAGGTGCGGGCCCACAGG - Intronic
1165392723 19:35547723-35547745 TGGCAGAGGCCAGGGCCCTCAGG + Intergenic
1165583071 19:36886556-36886578 AGGAAGAGGGCCAGGCCCGCTGG + Intronic
1165652051 19:37500086-37500108 AGGCAGAGCCGCAGGCACACAGG - Intergenic
1165742366 19:38211603-38211625 CGGCAGAGGCGGGTGCCCGGTGG + Intronic
1166084710 19:40467167-40467189 TGGCTGAGCCGCGGGCCGGCGGG + Intronic
1167281648 19:48572733-48572755 AGGCTGAGTCGAGGGCCCACAGG + Intronic
1167499723 19:49838362-49838384 AGGCAGAAGGGCGGGCCCAGGGG - Intronic
1167960778 19:53102972-53102994 AGGCGGAGGCGCGGCCTCCCCGG + Intronic
1167971889 19:53192921-53192943 AGGCAGAGGCGCGGCCTCCCCGG + Intronic
926095618 2:10079611-10079633 AGGCGGGGCCGCGGGCCCGAGGG + Intronic
927714269 2:25342073-25342095 GGGCGGAGGCCTGGGCCCGCGGG - Intronic
929604640 2:43226464-43226486 GTGCAGCGGCGCGGGCCGGCGGG + Exonic
930096398 2:47570116-47570138 AGGCGGAGGCGCGGGCGCGCTGG - Exonic
931348805 2:61470769-61470791 AGGCGGAGGAGGGGGCCGGCCGG + Exonic
932414961 2:71568090-71568112 AGGCAGAGGTGGGGGCTGGCAGG - Intronic
935052453 2:99535473-99535495 AGGCAGAGGACAGGGCCAGCTGG - Intergenic
935205652 2:100894525-100894547 AGTCAGAGCCGCGGGCACACAGG + Intronic
936340045 2:111623136-111623158 AGGCATAGGCCCAGGCCCACTGG - Intergenic
945979042 2:216294198-216294220 AGGCAAAGGCACAGGCCCCCTGG + Intronic
946414932 2:219535188-219535210 GGGCAGAAGCACGGGCCCTCAGG - Exonic
947200589 2:227611548-227611570 TGGCAGAGGCCATGGCCCGCAGG + Exonic
947517890 2:230823185-230823207 AGGAAGAGCCGCAGGCCAGCTGG + Intergenic
947745011 2:232502968-232502990 AGGCAGAGGCGGGGGCGGGAGGG + Intergenic
949036368 2:241817310-241817332 AGGGCCAGGCGCGGGACCGCAGG + Exonic
1170460604 20:16573507-16573529 GTGCAGAGGGGCGGGGCCGCGGG + Intergenic
1172146648 20:32762401-32762423 AGGAAGCGGCGCGGGCCGGACGG - Exonic
1173165672 20:40685421-40685443 AGGCAAAGGCCCGGGTCAGCTGG + Intergenic
1174411436 20:50339298-50339320 AGGCAGGGGCTCGGGGCCTCTGG - Intergenic
1175562043 20:59939249-59939271 GCGCGGTGGCGCGGGCCCGCAGG - Exonic
1175748318 20:61477134-61477156 AGGCAGAGGCGTGGGGAGGCAGG - Intronic
1175758975 20:61548305-61548327 AGGCTGAGGCTCGGGCAGGCAGG + Intronic
1176195682 20:63835559-63835581 TGGCAGGGGCGCAGGCCCGGAGG - Intergenic
1176547285 21:8207449-8207471 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1176555190 21:8251658-8251680 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1176566236 21:8390496-8390518 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1176574110 21:8434682-8434704 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1178684776 21:34702352-34702374 ATGCAGAGGCGTGGGGGCGCAGG + Intronic
1178695766 21:34792087-34792109 AGGCGAAGGCGGCGGCCCGCGGG + Exonic
1179796728 21:43789374-43789396 AGGCGCAGGCGCGCGCTCGCTGG + Intergenic
1179879204 21:44286445-44286467 AGGCAGAGGCGCTGGCGACCTGG - Intronic
1179994586 21:44968055-44968077 AGGCCCAGGCCCAGGCCCGCTGG - Intronic
1180232691 21:46436817-46436839 AGGCAGAGCCAGGGGCCCACGGG - Intronic
1180742814 22:18065492-18065514 AGGCAGAGGCGGGGGCAGGAGGG + Intergenic
1181633193 22:24162116-24162138 AGGCAGAGTCACGAGCCAGCAGG - Intronic
1181802736 22:25358108-25358130 AGGCAGAGGGGCTGGCCGGCTGG - Intronic
1181948170 22:26534677-26534699 AAGCAGAGGCGAGGGCCGGCTGG - Intronic
1182487226 22:30646800-30646822 GGGCAGAGGTGAGGGCCAGCAGG - Exonic
1184035146 22:41914664-41914686 AGCGGGAGGCGCGGGCCCGATGG - Exonic
1184265291 22:43343104-43343126 CGGCCGAGGCGCGGTCCCGGAGG - Intronic
1184727307 22:46354598-46354620 AGACGGAGGCGGGGGCCAGCAGG + Intronic
1184806567 22:46798416-46798438 GGGCAGAGGGGCAGGCCCACAGG + Intronic
1185326596 22:50228669-50228691 AGGCAGAGGCTCAGCCCCGGGGG - Intronic
1203252158 22_KI270733v1_random:123734-123756 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1203260212 22_KI270733v1_random:168817-168839 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
950136017 3:10581446-10581468 AGGCAGGGGCACGAGCCAGCCGG + Intronic
950586551 3:13896148-13896170 GGGCAGAGGCGCAGCCCCCCGGG - Intergenic
954335140 3:49911887-49911909 AGGCAGCGGCGGGGGACCCCTGG + Exonic
955368677 3:58332749-58332771 AGGCGGAGGAGCGGGCCAGCGGG + Intergenic
960156792 3:114304728-114304750 AGGCAGAGGCAGGGCCCAGCAGG + Intronic
960338267 3:116445039-116445061 ACGCCGAGGTGCGGGTCCGCGGG + Exonic
963733070 3:148991428-148991450 CGGCAGGGGCGGTGGCCCGCGGG - Exonic
966592184 3:181695583-181695605 AAGCGGAGGCGCGGGCCGGCGGG - Intergenic
967859738 3:194141709-194141731 AGGCGGCCGCGCGGCCCCGCCGG + Intergenic
968056668 3:195697094-195697116 AGGCAGAGACGAGGCCACGCGGG + Intergenic
968485328 4:858167-858189 GGGCAGAGGCGCCAGCCAGCAGG - Intronic
968494888 4:910095-910117 GGGCAGAGCCAGGGGCCCGCAGG + Intronic
968531104 4:1092124-1092146 AAGCAGAGGCGCTTGCCTGCAGG - Intronic
968624245 4:1619363-1619385 GGGCAGAGGCCAGGGCCAGCTGG + Intronic
968646951 4:1745977-1745999 AGGCAGAGGCTTGGCCCAGCTGG + Intergenic
968674470 4:1870535-1870557 AGGAAGCGGCGCGGGCGAGCGGG - Intergenic
969115030 4:4866017-4866039 AGGCGGAGGCGCGCGCGGGCCGG - Intergenic
969362649 4:6674403-6674425 AGGCAGAGGAGCGGGGCGCCCGG + Intergenic
969592044 4:8127595-8127617 AGGGAGAGCCGCCGACCCGCTGG - Intronic
969597787 4:8158731-8158753 AGCCAGACCCTCGGGCCCGCAGG + Intronic
969705411 4:8788896-8788918 AGGGAGAGGCGGAGGCCCACAGG + Intergenic
969705571 4:8789423-8789445 AGGGAGAGGCAGAGGCCCGCAGG + Intergenic
969705592 4:8789485-8789507 AGGGAGAGGCGGAGGCCTGCAGG + Intergenic
984805297 4:183746481-183746503 AGGCAGGGGGCCGTGCCCGCTGG + Intergenic
985472376 5:53923-53945 GGGCAGAGGGGCGGGCCCGGGGG + Intergenic
985553018 5:542820-542842 AAGCAGAGGCGCGGGACAGCGGG + Intergenic
985580833 5:694319-694341 AGGCCGAGGCGCAGCCCCCCAGG + Intergenic
985588174 5:751465-751487 AGGCAGGGGCGGGGGCATGCAGG + Intronic
985595455 5:785651-785673 AGGCCGAGGCGCAGCCCCCCAGG + Intergenic
985602844 5:843928-843950 AGGCAGGGGCGGGGGCATGCAGG + Intronic
985722143 5:1494973-1494995 AGGCACAGGGGCGGTCCCACGGG + Intronic
990545124 5:56815254-56815276 AGGCGGAGGCGTGGGCTCCCGGG - Intergenic
992530140 5:77645309-77645331 CGGCGGCGGCGCGGGCCGGCTGG - Intergenic
992663544 5:78984707-78984729 CGGCCGGGGCGCGGGTCCGCGGG + Intronic
993646900 5:90473960-90473982 AGGCCGAGGCGCTGGCTCGCGGG - Exonic
994353071 5:98769037-98769059 AGGCAGCGCCGCCGGCCCGGAGG + Intronic
997337574 5:133118938-133118960 AGGCAGAGTGGTGGGCCGGCAGG - Intergenic
997510320 5:134449509-134449531 GGGCACAGGCAGGGGCCCGCAGG - Intergenic
998254444 5:140573917-140573939 TAGAAGAGGCTCGGGCCCGCCGG - Intronic
999781997 5:154857563-154857585 AGGCGGAGGCGCGCCCCAGCTGG + Intronic
1001556551 5:172641195-172641217 AGCCACCGGCCCGGGCCCGCCGG - Intergenic
1002195191 5:177497400-177497422 AGGCAGGGGCCAGGGCCAGCGGG + Intronic
1002580884 5:180208969-180208991 GGGCAAGGGCGCGGGCTCGCGGG - Intronic
1006749056 6:36365223-36365245 GGGCAGAGGCTCTGGCCCTCAGG + Intronic
1009437729 6:63636479-63636501 CCGCTGAGGCGCGGGCGCGCAGG + Intronic
1012410120 6:98947627-98947649 AAGCGGAGGCGCGGGGGCGCGGG + Intronic
1014550998 6:122789556-122789578 CGGCAGAGGCTCGGGCTAGCGGG + Intronic
1015554960 6:134451734-134451756 AGGCAGGGGCCTGGGCCTGCAGG - Intergenic
1015776825 6:136822832-136822854 AGGCGGAGGCGGGGGCCAGCCGG + Intronic
1016357757 6:143236281-143236303 CGGCAGAGGCCCTGCCCCGCTGG - Intronic
1016461594 6:144285082-144285104 CTGCAGAGGCGCGGGCCGGAGGG + Intergenic
1018795565 6:167182669-167182691 AGGCAGAGGTGGGTGACCGCTGG - Exonic
1018820754 6:167372394-167372416 AGGCAGAGGTGGGTGACCGCTGG + Exonic
1019576987 7:1742369-1742391 AGGCAGAGGCGCGTGCTGGCCGG - Intronic
1022101768 7:27173445-27173467 CGGCAGCGGCGGGGGCTCGCAGG - Exonic
1022495415 7:30850190-30850212 AGGCAGAGGAAAGGGCCCACAGG - Intronic
1023298094 7:38737616-38737638 AAGCAGGGGCGAGGGCCTGCTGG + Intronic
1023703112 7:42911957-42911979 ACGCAGAGGCCGGGACCCGCCGG + Exonic
1024262373 7:47582058-47582080 AGCCTGAGGCGCGGTCCGGCAGG + Exonic
1024797489 7:53036298-53036320 AGGCAGAGGGCCGGGGCTGCAGG - Exonic
1025007472 7:55365753-55365775 ACGGAGAGGAGCGGGCTCGCGGG - Exonic
1026458952 7:70596406-70596428 AGGCAGAGGCAGAGGCCGGCTGG + Intronic
1026899163 7:74027667-74027689 GGGCTGAGGCGCGGGACAGCTGG + Intergenic
1027138245 7:75639317-75639339 CGGGGGAGGCGCGGCCCCGCCGG + Intronic
1027361585 7:77415926-77415948 TGGCAGAGGGGCCGGGCCGCTGG - Intronic
1032011930 7:128352479-128352501 GGGCAGAGGCCAGGGCTCGCTGG - Exonic
1033477178 7:141702163-141702185 AGGCGGAGCCGCGGGCGCGAGGG + Intergenic
1034105159 7:148483671-148483693 AGGAGGAGGCGCCGGCCCTCAGG - Intergenic
1034876597 7:154730005-154730027 AGGCAGAGGTGCAGCCCCTCCGG - Intronic
1036180138 8:6577172-6577194 AGGAAGAGGCGCTGGCCACCTGG - Intronic
1036578823 8:10054392-10054414 CGGCAGGGGCGCGGGCGGGCGGG - Exonic
1038011586 8:23480667-23480689 AGGCATGGGAGCGGCCCCGCCGG - Intergenic
1038018918 8:23536688-23536710 AGGCAGAAGGGCAGGCCCGAGGG - Intronic
1040872873 8:52118981-52119003 AGGCAGAGCTGCGGGGCTGCTGG + Intronic
1043436544 8:80240802-80240824 AGGCGGACGCGCGGGGCCGCAGG - Intergenic
1044819054 8:96143800-96143822 AGGCAGAGACCTGGGCCCTCAGG + Exonic
1047203189 8:122782779-122782801 TGGCAGAGGCTCCGGCCAGCTGG - Intronic
1048073192 8:131041684-131041706 AGGCAGAGGCACGCGCGGGCCGG + Exonic
1049096476 8:140551267-140551289 AGGCAGAGGCTCCGGCCTGGGGG - Intronic
1049425237 8:142535247-142535269 AGGCAGAGCCCAGGGCCAGCTGG + Intronic
1049443069 8:142617984-142618006 AGGCAGAGTTGGGGGCCCTCTGG - Intergenic
1049573356 8:143379661-143379683 AGGCAGAGGCTCGGGTCCCCAGG - Intronic
1049671914 8:143873710-143873732 AGGCTGAGGGGCGGGCCCTGTGG - Intronic
1052473755 9:28932156-28932178 AGGCAGTGGCGGGGGCCGGGGGG + Intergenic
1052807539 9:33025743-33025765 AGGCAGGGGCGAGGGGCTGCGGG + Intronic
1054768959 9:69067053-69067075 AGGCAGAGAAGCGGGCCCTGAGG + Intronic
1056922328 9:90801788-90801810 AGGAAGAGCCGCGGGCCCGGCGG + Exonic
1057215344 9:93224803-93224825 AGTCAGAGGCGGGGGCCTCCTGG - Intronic
1057856765 9:98606940-98606962 AGGCGGAGCCGCGGGCAAGCAGG - Intronic
1057905219 9:98977667-98977689 ATGGATAGGCGCTGGCCCGCAGG - Intronic
1057921987 9:99105154-99105176 AGGCAGCGGCGCGGCCGGGCCGG + Exonic
1059042634 9:110830672-110830694 AGACACAGGCACCGGCCCGCCGG - Intergenic
1059176766 9:112175253-112175275 GGGAGGAGGCGCGGGCGCGCCGG - Exonic
1060223130 9:121774806-121774828 AGGCAGAGGCATGGGTCCCCAGG + Intronic
1060856026 9:126915254-126915276 GGGAAGAGGCGCGGGCGCGGGGG + Intronic
1060936673 9:127519999-127520021 AGGCAGAGGGCCGGGACAGCGGG + Intronic
1061348078 9:130042842-130042864 GGGCGGAGGCGAGGGCGCGCTGG - Intronic
1061578168 9:131520682-131520704 AGGCAGAGGCTCAGGCCCAGAGG + Intronic
1061869846 9:133514863-133514885 TGGCAGAGGCGGGGGCCTGAAGG - Intronic
1061882559 9:133575410-133575432 GGGCAGAGGCGCTTGCCCACGGG + Exonic
1061933479 9:133845210-133845232 AGGCAGAAGCGTGGACGCGCTGG + Intronic
1062525701 9:136977294-136977316 AGGCAGAGGCCCCTGCCCACTGG - Intergenic
1062621248 9:137423445-137423467 AGGCGGCGGCGCGGGGCTGCGGG - Exonic
1203761053 EBV:13134-13156 AGGGAGAGGCTCGGGCCTGGAGG - Intergenic
1203761982 EBV:16206-16228 AGGGAGAGGCTCGGGCCTGGAGG - Intergenic
1203762911 EBV:19278-19300 AGGGAGAGGCTCGGGCCTGGAGG - Intergenic
1203763840 EBV:22350-22372 AGGGAGAGGCTCGGGCCTGGAGG - Intergenic
1203764769 EBV:25422-25444 AGGGAGAGGCTCGGGCCTGGAGG - Intergenic
1203765698 EBV:28494-28516 AGGGAGAGGCTCGGGCCTGGAGG - Intergenic
1203766627 EBV:31566-31588 AGGGAGAGGCTCGGGCCTGGAGG - Intergenic
1203767556 EBV:34638-34660 AGGGAGAGGCTCGGGCCTGGAGG - Intergenic
1203468561 Un_GL000220v1:106884-106906 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1203476382 Un_GL000220v1:150856-150878 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1185643207 X:1599762-1599784 ACACAGAGGCGCGGGCCAGAGGG - Intronic
1185697470 X:2206066-2206088 AGGCAGAGGGCCGGGCGCGGTGG - Intergenic
1189310034 X:40012470-40012492 GGGCAGAGGAGCGAGCCTGCCGG + Intergenic
1190246899 X:48696816-48696838 AGGCAGAGGCGCGGGCCCGCTGG + Intronic
1190640798 X:52481706-52481728 AGGCAGAGGCACGTCCCTGCAGG + Intergenic
1190646874 X:52531159-52531181 AGGCAGAGGCACGTCCCTGCAGG - Intergenic
1190690241 X:52907734-52907756 AGGCAGAGGCCCGGGCTGGTTGG - Exonic
1190695742 X:52948058-52948080 AGGCAGAGGCCCGGGCTGGTTGG + Exonic
1192553857 X:72074519-72074541 AGGCAGAGGCACAGGCCCTGGGG + Intergenic
1200173798 X:154097789-154097811 AGGGCGGGGCGCGGGCGCGCAGG - Intergenic
1200225238 X:154413378-154413400 AGGCACAGGGGAGGGCCTGCGGG - Intronic