ID: 1190254618

View in Genome Browser
Species Human (GRCh38)
Location X:48753342-48753364
Sequence TGGGGAAGGAATGATGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190254618_1190254623 -5 Left 1190254618 X:48753342-48753364 CCTCCAGCATCATTCCTTCCCCA No data
Right 1190254623 X:48753360-48753382 CCCCAATGTGTGTGACCCCAGGG No data
1190254618_1190254621 -6 Left 1190254618 X:48753342-48753364 CCTCCAGCATCATTCCTTCCCCA No data
Right 1190254621 X:48753359-48753381 TCCCCAATGTGTGTGACCCCAGG No data
1190254618_1190254625 -4 Left 1190254618 X:48753342-48753364 CCTCCAGCATCATTCCTTCCCCA No data
Right 1190254625 X:48753361-48753383 CCCAATGTGTGTGACCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190254618 Original CRISPR TGGGGAAGGAATGATGCTGG AGG (reversed) Intergenic
No off target data available for this crispr