ID: 1190254760

View in Genome Browser
Species Human (GRCh38)
Location X:48754152-48754174
Sequence ACTCCTAGTGTTACACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190254760_1190254765 6 Left 1190254760 X:48754152-48754174 CCAGTCTGTGTAACACTAGGAGT No data
Right 1190254765 X:48754181-48754203 TCCACAATGTGTGATTTCAGGGG No data
1190254760_1190254764 5 Left 1190254760 X:48754152-48754174 CCAGTCTGTGTAACACTAGGAGT No data
Right 1190254764 X:48754180-48754202 GTCCACAATGTGTGATTTCAGGG No data
1190254760_1190254763 4 Left 1190254760 X:48754152-48754174 CCAGTCTGTGTAACACTAGGAGT No data
Right 1190254763 X:48754179-48754201 GGTCCACAATGTGTGATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190254760 Original CRISPR ACTCCTAGTGTTACACAGAC TGG (reversed) Intergenic
No off target data available for this crispr