ID: 1190255051

View in Genome Browser
Species Human (GRCh38)
Location X:48756102-48756124
Sequence CAGAGTGAAATGAATGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190255048_1190255051 12 Left 1190255048 X:48756067-48756089 CCTTGTAAATGTCCATTTATAAA No data
Right 1190255051 X:48756102-48756124 CAGAGTGAAATGAATGATGGAGG No data
1190255049_1190255051 0 Left 1190255049 X:48756079-48756101 CCATTTATAAAGAATGACTGTTG No data
Right 1190255051 X:48756102-48756124 CAGAGTGAAATGAATGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190255051 Original CRISPR CAGAGTGAAATGAATGATGG AGG Intergenic
No off target data available for this crispr