ID: 1190255269

View in Genome Browser
Species Human (GRCh38)
Location X:48757773-48757795
Sequence AGTTATCTGCAGAGAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190255269_1190255277 17 Left 1190255269 X:48757773-48757795 CCTGCTATTCTCTGCAGATAACT No data
Right 1190255277 X:48757813-48757835 CAGCTCTTGGCTGGGTGTGGTGG No data
1190255269_1190255272 4 Left 1190255269 X:48757773-48757795 CCTGCTATTCTCTGCAGATAACT No data
Right 1190255272 X:48757800-48757822 TCCTTTTGAGAAACAGCTCTTGG No data
1190255269_1190255276 14 Left 1190255269 X:48757773-48757795 CCTGCTATTCTCTGCAGATAACT No data
Right 1190255276 X:48757810-48757832 AAACAGCTCTTGGCTGGGTGTGG No data
1190255269_1190255274 8 Left 1190255269 X:48757773-48757795 CCTGCTATTCTCTGCAGATAACT No data
Right 1190255274 X:48757804-48757826 TTTGAGAAACAGCTCTTGGCTGG No data
1190255269_1190255275 9 Left 1190255269 X:48757773-48757795 CCTGCTATTCTCTGCAGATAACT No data
Right 1190255275 X:48757805-48757827 TTGAGAAACAGCTCTTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190255269 Original CRISPR AGTTATCTGCAGAGAATAGC AGG (reversed) Intergenic
No off target data available for this crispr