ID: 1190255320

View in Genome Browser
Species Human (GRCh38)
Location X:48758146-48758168
Sequence AACAGCTCTTGGTCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190255317_1190255320 18 Left 1190255317 X:48758105-48758127 CCCTGTCTCAAAAAAAAAAAAAA 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502
Right 1190255320 X:48758146-48758168 AACAGCTCTTGGTCTGCTACTGG No data
1190255318_1190255320 17 Left 1190255318 X:48758106-48758128 CCTGTCTCAAAAAAAAAAAAAAA 0: 13279
1: 16490
2: 27851
3: 54067
4: 109329
Right 1190255320 X:48758146-48758168 AACAGCTCTTGGTCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190255320 Original CRISPR AACAGCTCTTGGTCTGCTAC TGG Intergenic
No off target data available for this crispr