ID: 1190255320 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:48758146-48758168 |
| Sequence | AACAGCTCTTGGTCTGCTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1190255317_1190255320 | 18 | Left | 1190255317 | X:48758105-48758127 | CCCTGTCTCAAAAAAAAAAAAAA | 0: 13494 1: 16907 2: 33917 3: 145359 4: 149502 |
||
| Right | 1190255320 | X:48758146-48758168 | AACAGCTCTTGGTCTGCTACTGG | No data | ||||
| 1190255318_1190255320 | 17 | Left | 1190255318 | X:48758106-48758128 | CCTGTCTCAAAAAAAAAAAAAAA | 0: 13279 1: 16490 2: 27851 3: 54067 4: 109329 |
||
| Right | 1190255320 | X:48758146-48758168 | AACAGCTCTTGGTCTGCTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1190255320 | Original CRISPR | AACAGCTCTTGGTCTGCTAC TGG | Intergenic | ||
| No off target data available for this crispr | |||||