ID: 1190257309

View in Genome Browser
Species Human (GRCh38)
Location X:48773312-48773334
Sequence TTGTGATGTCCCTATTGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190257309 Original CRISPR TTGTGATGTCCCTATTGAGG AGG Exonic
905187889 1:36209849-36209871 TTGGGATGTCCCCTTTGGGGTGG - Intergenic
912705557 1:111909346-111909368 GTGTGAGGACCCTATTGAGGGGG + Intronic
915745464 1:158153504-158153526 ATGTGAAGTCCCCATTTAGGAGG + Intergenic
916289349 1:163147470-163147492 TTGTGATGTCCTTAGTGAAGTGG + Exonic
923774629 1:236967385-236967407 TTTTGATGTCCCTAGTGTTGGGG - Intergenic
1064009974 10:11727854-11727876 TGGTGAGGCCCCTGTTGAGGGGG + Intergenic
1064256179 10:13744343-13744365 GTGCGATTTCCCTGTTGAGGAGG - Intronic
1066056444 10:31685463-31685485 TCGTGATGGCCCTACTGAGTGGG - Intergenic
1074711409 10:116181043-116181065 TTTTGATGACGCTCTTGAGGTGG + Intronic
1078463061 11:11530126-11530148 TTGTGATGCCTCTAGTAAGGAGG + Intronic
1080161842 11:29185799-29185821 TTGTGTTTTCCCTCTTGGGGAGG - Intergenic
1081681776 11:45011279-45011301 TTTTGATGTCAGGATTGAGGTGG + Intergenic
1084988911 11:72904350-72904372 TTGTTTTGTTCCTCTTGAGGAGG + Intronic
1085989736 11:81827561-81827583 ATGTGATGTCTATATTGAGATGG + Intergenic
1089889126 11:121861764-121861786 TAGGGAAGACCCTATTGAGGAGG + Intergenic
1090343729 11:126049512-126049534 TTCTGATGACCATATTGAGAAGG - Intronic
1090623708 11:128586164-128586186 TTGTTATTTCACTATTGAGTTGG + Intronic
1092765790 12:11851477-11851499 TGGTGATGTCTCTGATGAGGCGG - Intronic
1095155140 12:38843688-38843710 TTGTCTTGTCCTTATGGAGGAGG - Intronic
1096496078 12:52040202-52040224 TTGTGATGTGACTATTGAGGGGG + Intronic
1097048450 12:56205421-56205443 TTTTGATGTTCCTATTGTGGGGG - Exonic
1102656803 12:114488965-114488987 TTGTGATGTCCATTTTGCAGAGG + Intergenic
1103767728 12:123293570-123293592 TTGTGAGGTCCATTTTGAGAGGG + Exonic
1104444766 12:128824029-128824051 CTGAGATGTCCCTATTGGGCGGG + Intergenic
1106582736 13:31031946-31031968 TTTTGATGTTCCCAATGAGGTGG - Intergenic
1109661911 13:65471304-65471326 ATGTGATTGCCTTATTGAGGTGG + Intergenic
1113431385 13:110254690-110254712 TAGTGATGTCGCTATTCTGGGGG - Intronic
1118315828 14:64725548-64725570 TTGTAAAGGCCCTTTTGAGGAGG + Intronic
1119105590 14:71920370-71920392 TTGTGTTGTCCCCATTGTGAGGG + Intergenic
1121025434 14:90612592-90612614 TGGTGCTGTCACTAATGAGGAGG + Intronic
1125167816 15:36729377-36729399 TTGAAATGTCCATATTGGGGAGG + Intronic
1130905792 15:88240203-88240225 TTGTGATGTTTCTATGGCGGTGG - Intronic
1132028330 15:98421119-98421141 CTGTGGTGTCCCGATTGAGGGGG - Intergenic
1137052047 16:35722723-35722745 GTGAGAAGTCCCTATTGGGGAGG - Intergenic
1137643256 16:50052015-50052037 TTGAGATGTGCCTATTCATGTGG - Intergenic
1141544233 16:84753443-84753465 TTCTGATGTCTGTATTGAGCTGG + Intronic
1149977887 17:61284883-61284905 TTCTGCTGTCCCTTCTGAGGTGG - Intronic
1154094689 18:11401696-11401718 TTGTGATGTCACTAATGCAGCGG - Intergenic
1157326077 18:46669584-46669606 TTGTGTTGTCCTTATTGTGTGGG - Intronic
1164812856 19:31171785-31171807 ATGTGATGTCAGTATTGAGAAGG + Intergenic
1167841581 19:52125964-52125986 TTGTCATCTCCCTATTGAAGAGG - Intronic
925110323 2:1330028-1330050 TTGTGAGGGGCCTTTTGAGGTGG + Intronic
926820040 2:16841902-16841924 TTGTGATGTTTCTACTGAGGAGG - Intergenic
928767747 2:34668113-34668135 TTGTGATTTCCCCACTAAGGAGG - Intergenic
930427585 2:51231564-51231586 TTGAGATGTCCCTTTGGAGAGGG + Intergenic
931211413 2:60200041-60200063 TTATGGTCTACCTATTGAGGAGG - Intergenic
937173724 2:119903983-119904005 TTGTGATGTACCTATAGTGTTGG - Intronic
939510990 2:143104408-143104430 ATGTGAAGTCCCTATTGTAGTGG - Intronic
944479652 2:200143768-200143790 TTGTAATCCCCATATTGAGGTGG - Intergenic
948546169 2:238730352-238730374 GTCTGAGGTCCCTACTGAGGAGG - Intergenic
1169555227 20:6742455-6742477 TTTTGATGTCCATATTGACATGG + Intergenic
1171271075 20:23817808-23817830 TTGTGGTGTCCTGTTTGAGGGGG + Intergenic
1174374037 20:50113364-50113386 TTGTGATGTGCTTAGTGAGAAGG + Intronic
1181103839 22:20560020-20560042 TTGGGATGTCACTACTGTGGGGG + Intronic
954215537 3:49122365-49122387 TTGCTGTGTCCCTATAGAGGAGG - Exonic
954913788 3:54131733-54131755 TTATTATGTCCCTAGGGAGGTGG + Intronic
958609522 3:96406750-96406772 TTGTGATGTTCATATTGAGTAGG - Intergenic
961356620 3:126343627-126343649 TTGCCATGTCCCTCTGGAGGAGG + Exonic
963101532 3:141611105-141611127 TAATGAAGTCCCAATTGAGGTGG + Intronic
964094289 3:152913502-152913524 TTGTGATGTCGCTAGTGTGATGG + Intergenic
967115087 3:186330063-186330085 TTTACATGTCCCTATAGAGGAGG + Intronic
978259659 4:106740145-106740167 TTGTGAAGGCCTTATTGAGAAGG + Intergenic
984493266 4:180463451-180463473 TTGACATGTACTTATTGAGGAGG + Intergenic
985188089 4:187339491-187339513 TTGTGATACTCTTATTGAGGTGG - Intergenic
991129101 5:63101157-63101179 TTCTGATGTCCCTGTTCAAGAGG + Intergenic
996936521 5:128955741-128955763 GTGTGATGAGCATATTGAGGGGG + Intronic
999253332 5:150195526-150195548 TGGTGATGACCCTATTGGGTAGG + Intronic
1016598229 6:145825600-145825622 TAGTGGTGTTCATATTGAGGTGG + Intergenic
1016729110 6:147408260-147408282 TTCTGATGTCCTTAATGACGTGG + Intergenic
1018008189 6:159642758-159642780 TTTTTCTTTCCCTATTGAGGAGG - Intergenic
1021032770 7:15759649-15759671 TTGTGAGGTCACTAGTGATGTGG - Intergenic
1022065536 7:26851938-26851960 TTTTGATGTCACTATTGGGGGGG - Intronic
1022320012 7:29279318-29279340 TTGTGGTATCCCTATTAAGAAGG - Intronic
1032438992 7:131927451-131927473 GTGTGATGTCCCTAAAGATGAGG + Intergenic
1039728572 8:40250021-40250043 GCGTGATGTCCCTATTGAAATGG + Intergenic
1040460752 8:47645424-47645446 TAGTGATGGCCTTGTTGAGGTGG + Intronic
1043727476 8:83629198-83629220 TTGGGATGTCCCTCTTGGTGGGG + Intergenic
1044787646 8:95811657-95811679 CTGTGCTGTCCCTATTGGGGTGG - Intergenic
1044916105 8:97114025-97114047 ATGAGATTTCCCTATTAAGGAGG + Intronic
1045317717 8:101057812-101057834 ATGTGCTGGCCCTATTGGGGTGG + Intergenic
1052220314 9:26014024-26014046 TTTTGAAGTCTCTAGTGAGGAGG + Intergenic
1058297989 9:103332862-103332884 TAGTTATGTCCCTGGTGAGGGGG - Intergenic
1062058510 9:134481988-134482010 TTGTGATGTCTCTCTTGCTGAGG - Intergenic
1186440178 X:9579281-9579303 TTGTGATGACACTTTTGAGAGGG - Intronic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1186982929 X:14977232-14977254 TTGGGATGTGCCTGTTCAGGTGG - Intergenic
1189610631 X:42730447-42730469 TTTTGATGTTCTTATTGAGTGGG - Intergenic
1190257309 X:48773312-48773334 TTGTGATGTCCCTATTGAGGAGG + Exonic
1192781779 X:74301380-74301402 TTTTTATGTCCATATTGATGAGG - Intergenic
1194966382 X:100293337-100293359 TTCTGATGTCCCTTTTAAGGAGG - Exonic
1195647631 X:107250156-107250178 TTGTGATATCCCTTTTCATGGGG + Intergenic
1197261345 X:124321783-124321805 TTGTGATGTGCTTATTCAAGTGG + Intronic
1197800871 X:130346995-130347017 TTGTGATATCCCTCCTGAGTTGG + Intronic
1200353641 X:155525690-155525712 CTGTGAAGTCCATACTGAGGTGG + Intronic
1200648886 Y:5816805-5816827 TTGTGCTGTCCCTCTTGGGAAGG + Intergenic
1200960779 Y:8993999-8994021 TTGTCATGTCCCACTGGAGGAGG - Intergenic