ID: 1190261743

View in Genome Browser
Species Human (GRCh38)
Location X:48801991-48802013
Sequence GACCGAAGGCGGCTAGGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190261743 Original CRISPR GACCGAAGGCGGCTAGGGAC TGG Exonic
901634110 1:10662790-10662812 GCAGGAAGGCGGCTAGGGATGGG - Intronic
905657151 1:39692244-39692266 GACTGGCGGCGGCTGGGGACCGG - Intronic
910967030 1:92818248-92818270 GAGAGAAGGCGGCTAATGACAGG - Intergenic
915491408 1:156251946-156251968 GACCGAAGCCAGCCAGGGAGGGG - Intronic
921166700 1:212513179-212513201 GACCCAAGGCAGCTGGGGCCAGG + Intergenic
1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG + Intronic
1081767434 11:45621388-45621410 GACTGAGGGCAGCTAGGCACAGG - Intergenic
1084350852 11:68598099-68598121 GAATGGAGGCTGCTAGGGACTGG - Intronic
1085048080 11:73364740-73364762 GATCGAAGGAGGACAGGGACTGG - Intronic
1091992156 12:4964120-4964142 AAACGAAGGTGGCTAGGGTCAGG - Intergenic
1102240175 12:111320292-111320314 GCACGAAGGCGGCGGGGGACAGG - Exonic
1102823709 12:115928471-115928493 GACCGAAAAGGGCTAGGGACTGG + Intergenic
1104692770 12:130839135-130839157 GGCCGGAGGCAGCTCGGGACAGG - Exonic
1119741685 14:77017886-77017908 AACTGAAGGAGTCTAGGGACAGG - Intergenic
1121273051 14:92650780-92650802 CACCAAAGCAGGCTAGGGACAGG - Intronic
1128672595 15:69585735-69585757 GGCCCATGGAGGCTAGGGACAGG - Intergenic
1129791226 15:78341704-78341726 GGCCGAAGGCGGGAAGGGAGAGG - Intronic
1137722142 16:50633541-50633563 GCCCGAGGGGGGCTAGGGAGGGG - Exonic
1144581908 17:16463909-16463931 GACAGATGGCGGGCAGGGACGGG + Intronic
1146721070 17:35123871-35123893 CACAGAAGGCCGCTAGGCACTGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148889636 17:50798604-50798626 CACAGAAGGCGTCTAGGGAAGGG + Intergenic
1154991204 18:21600142-21600164 GCCAGGAGGCGGCGAGGGACTGG + Intronic
1157659873 18:49431672-49431694 GACCAAAGGCGGCTCAGGTCAGG + Intronic
1161701785 19:5799914-5799936 GACCTAAGGCCCCCAGGGACGGG + Intergenic
1162888674 19:13716056-13716078 GACAGAAGCAGGCTAAGGACAGG - Intergenic
1164479147 19:28598148-28598170 GAGGGAGGGCTGCTAGGGACAGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1166915047 19:46189557-46189579 GACCAAAGTCGGCTAGGTAACGG + Intergenic
929330130 2:40672950-40672972 GACCCAAGGAGGCAAGGGTCAGG - Intergenic
936093434 2:109515150-109515172 GACCAATGGCGGCCAGGGCCAGG + Intergenic
948530649 2:238601336-238601358 GACCACGGGCGGGTAGGGACAGG - Intergenic
1168997421 20:2143755-2143777 GACAGAAGGCGGGTAAGGAGGGG - Intronic
1171217281 20:23361783-23361805 GACCGCAGGCTGCTGGGGCCCGG + Intergenic
1175853702 20:62107508-62107530 GACCCCAGGCAGGTAGGGACCGG - Intergenic
1180156857 21:45982169-45982191 GACCGCAGGCAGCTCGGGAGGGG + Intronic
1185245535 22:49771057-49771079 GACCGGAGCCGGCTGGGGATGGG - Intergenic
952355405 3:32578967-32578989 GAGAGAAGGCAGCTAAGGACCGG - Intergenic
952381012 3:32805412-32805434 GAATGATAGCGGCTAGGGACTGG + Intergenic
955326747 3:58014492-58014514 GAACGAAGGCGGCTGCCGACTGG - Intronic
956158583 3:66324235-66324257 GACAGCAGGGGGCTAGGGAATGG + Intronic
960699282 3:120425007-120425029 GGCCGAGGGCGGCTAGGGCGTGG + Intronic
961101004 3:124199034-124199056 GACCTAAGGAGGCTAAGGAAAGG + Intronic
966734807 3:183179982-183180004 GAGGGATGGAGGCTAGGGACAGG + Intronic
981118182 4:141016755-141016777 GAGCCAAGGCGGCCAGGGACAGG - Intronic
998952225 5:147403964-147403986 GACCTAGGGCCGCTCGGGACAGG - Intronic
1025733808 7:64129413-64129435 GACCGATGGTGGCCAGGGACTGG + Intronic
1026136539 7:67667178-67667200 GACAGAATGCGACTAGGGAAAGG - Intergenic
1026159697 7:67857801-67857823 GACTGATGGTGGCCAGGGACTGG + Intergenic
1029798117 7:102916550-102916572 GACTTAAAGCTGCTAGGGACGGG + Intronic
1045471637 8:102518032-102518054 GATCCAAGGAGGCTAGGGATGGG - Intergenic
1051383320 9:16480723-16480745 GCCGGAAGGCAGCTAGGGCCCGG - Intronic
1056026663 9:82504605-82504627 GAAAGATGGCGGATAGGGACAGG + Intergenic
1190261743 X:48801991-48802013 GACCGAAGGCGGCTAGGGACTGG + Exonic
1195086453 X:101418363-101418385 GACGGAAGGTGGCGAGGGAGAGG + Intronic