ID: 1190263425

View in Genome Browser
Species Human (GRCh38)
Location X:48813958-48813980
Sequence CTGGAGGCCCAAATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190263425_1190263434 23 Left 1190263425 X:48813958-48813980 CCATGCTCCATTTGGGCCTCCAG 0: 1
1: 0
2: 0
3: 24
4: 228
Right 1190263434 X:48814004-48814026 TACTACTACCTTTGTCATAGGGG 0: 1
1: 0
2: 1
3: 4
4: 100
1190263425_1190263433 22 Left 1190263425 X:48813958-48813980 CCATGCTCCATTTGGGCCTCCAG 0: 1
1: 0
2: 0
3: 24
4: 228
Right 1190263433 X:48814003-48814025 TTACTACTACCTTTGTCATAGGG 0: 1
1: 0
2: 1
3: 12
4: 201
1190263425_1190263435 27 Left 1190263425 X:48813958-48813980 CCATGCTCCATTTGGGCCTCCAG 0: 1
1: 0
2: 0
3: 24
4: 228
Right 1190263435 X:48814008-48814030 ACTACCTTTGTCATAGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 86
1190263425_1190263432 21 Left 1190263425 X:48813958-48813980 CCATGCTCCATTTGGGCCTCCAG 0: 1
1: 0
2: 0
3: 24
4: 228
Right 1190263432 X:48814002-48814024 GTTACTACTACCTTTGTCATAGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190263425 Original CRISPR CTGGAGGCCCAAATGGAGCA TGG (reversed) Intronic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
900378667 1:2373062-2373084 CTGCAGGCCCCGGTGGAGCAGGG - Intronic
903132714 1:21290157-21290179 CTGCAAGGCCAAATGCAGCACGG + Intronic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
905007231 1:34719627-34719649 CTGGAGGTGCAAATGGGGCATGG - Intronic
905892497 1:41526113-41526135 CTGATGGCCCCATTGGAGCAGGG - Intronic
909002446 1:70234746-70234768 CAGGAAGCCCAAGTGCAGCAAGG - Exonic
911164819 1:94715136-94715158 CTGGAGGACTAAGTGGACCAGGG + Intergenic
911809808 1:102261444-102261466 CTGTAGGCCCAAAAGGAAAAGGG - Intergenic
912822772 1:112881070-112881092 CTGGATGCCCAAGGGGAGCCGGG + Intergenic
914327602 1:146635534-146635556 AAGGAGGCCCAAATGGAAGATGG - Intergenic
915362520 1:155294719-155294741 CTGGTGACCCAAGTGGAGAACGG - Exonic
916682163 1:167114606-167114628 GTGGAGACCCAAATGGGTCAGGG - Intronic
920336373 1:205247938-205247960 CTCAAGCCCCAAAGGGAGCAGGG + Intronic
920351695 1:205342297-205342319 CTGGAGGCCCACGGAGAGCAAGG - Intronic
924185519 1:241485169-241485191 CTGGATGCCCAAATGGTGGGAGG + Intergenic
924827473 1:247555947-247555969 ATGGATGCCCACATGCAGCAGGG + Intronic
1063691598 10:8292845-8292867 CTGGAGGAAGAAATGCAGCACGG - Intergenic
1064755478 10:18568919-18568941 ATGGAGAACCAAATGGAGAATGG - Intronic
1065869091 10:29940949-29940971 CTGCACGCCCAAGAGGAGCATGG - Intergenic
1067062506 10:43085086-43085108 CTGGAGGCCAGCATGGAGCTGGG + Intronic
1067343839 10:45424160-45424182 CTGGGGGCCCAAGTGGTGCTGGG + Intronic
1067577747 10:47418868-47418890 CTGCTGGCCCAAATGGAGGATGG + Intergenic
1067797472 10:49331280-49331302 CTGGAGCCCCAAAAGTAGCCTGG - Intergenic
1073262729 10:102202773-102202795 CTGGAGGCCCCAGTAGGGCAAGG - Intergenic
1073417281 10:103395103-103395125 ATGGAGGGCCAAATGGGGAACGG + Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1077524843 11:3057765-3057787 CAGGAGGCCGACCTGGAGCAGGG + Intergenic
1077549637 11:3194394-3194416 GTGGAGGCCTAAATTCAGCAGGG - Intergenic
1080402502 11:31949192-31949214 ATGGAGGCCAAAAGAGAGCAGGG + Intronic
1080551547 11:33376853-33376875 CTGGCGGCCCTCCTGGAGCACGG + Intergenic
1080878452 11:36297776-36297798 CTGCAGGCCCCACTGGAGGAGGG - Intronic
1085485493 11:76860233-76860255 TTGGAGGCCCAAACGAAGCAGGG + Intergenic
1086218785 11:84416102-84416124 CTGGAGCACAAAATGGAGAAGGG - Intronic
1086943347 11:92820631-92820653 CTGGAAGCTCAAATGGAGGTTGG - Intronic
1087591152 11:100189303-100189325 CTGCATGCCCAAGTGGATCAGGG + Intronic
1088686477 11:112288457-112288479 CTGGAGGCCAAGAAGGAGCTGGG + Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1090203914 11:124874684-124874706 CTGGAGTACTAAGTGGAGCAGGG + Intronic
1090260111 11:125313283-125313305 CTGGAGTCCCTAATGGGGCCTGG + Intronic
1091131017 11:133147349-133147371 CTGGAGGCCAAAGTTGAGAAAGG + Intronic
1091368310 11:135039628-135039650 CAGGAAGCCCAAGTGGAGCTGGG + Intergenic
1091584011 12:1805717-1805739 CTGGAGGGCCCAGTGGAGCAGGG + Intronic
1093090769 12:14917753-14917775 CTGAAGGCTCAACTGGAGCTGGG - Intronic
1097441645 12:59615050-59615072 CAAGAGGCCCAAATGCTGCACGG - Intronic
1100397372 12:94196793-94196815 CAGGAGGACTAAATGGAACATGG - Intronic
1104680525 12:130748147-130748169 CTGGAGGCCTGCATGGAGCAGGG - Intergenic
1104732317 12:131114614-131114636 CTGGAGGCCCACCCAGAGCATGG + Intronic
1105773770 13:23637900-23637922 CCGGAGCCCAAAATGGAGCCTGG + Intronic
1106208915 13:27622661-27622683 GTGGATGGTCAAATGGAGCAGGG + Intronic
1110556088 13:76861013-76861035 CTGGAGGCAAAAATGGAAAATGG + Intergenic
1113738706 13:112696585-112696607 CTGGAAGCCAAAAATGAGCACGG - Intronic
1114450491 14:22822235-22822257 CTGGGGGCCCAAAGGAAGGAGGG - Intronic
1114479754 14:23025380-23025402 CTGGAGGACCAAAAGGACAAGGG + Intronic
1114903231 14:27092337-27092359 CGGGAGGACAAAATGGAGAATGG + Intergenic
1117969150 14:61235176-61235198 AGGGATGCCCATATGGAGCATGG - Intronic
1119473312 14:74912427-74912449 CTGGAGGTCCAGTTGGAACAGGG - Intronic
1119754398 14:77104617-77104639 GTGAAGGCCCTAAGGGAGCAAGG - Intronic
1121045483 14:90784714-90784736 TTTGAAGCCCAAATGCAGCAGGG + Intronic
1121275954 14:92667787-92667809 CTGAATGACCATATGGAGCATGG - Intronic
1121545170 14:94757906-94757928 CTGGAGAGCAACATGGAGCATGG + Intergenic
1121613667 14:95298408-95298430 CTGGAGACCAAACTGGTGCAAGG + Intronic
1122533157 14:102443163-102443185 ATGGAGGCCCAAAGGCTGCAGGG - Intronic
1122721603 14:103725451-103725473 CAGCAGCCCCAAATGGAGCGTGG - Intronic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1202831868 14_GL000009v2_random:43189-43211 CTGGAGGCCCACATGCAGTGGGG - Intergenic
1124195176 15:27619296-27619318 CTGGAGGGCAAACTGGAGTAGGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126982790 15:54264774-54264796 CTCGAGGACCAAATGGATGAGGG - Intronic
1128443200 15:67732726-67732748 CTGGAGCTCCATATGGAGCAGGG - Intronic
1128646034 15:69379638-69379660 CTGGATTCCCAAAGGGAGCCTGG + Intronic
1129466513 15:75727247-75727269 CTGGAGGCCAGACTGTAGCAGGG - Exonic
1130893851 15:88155381-88155403 CTGGAGGCTCTAAGGGAGAATGG - Intronic
1131427725 15:92360546-92360568 CTGGAGGAGCAAATGGGGGAAGG + Intergenic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1133921133 16:10154192-10154214 TTGTGGGCCCAGATGGAGCATGG - Intronic
1134034594 16:11020170-11020192 CTGGAAGCCAAAATGGAGACTGG - Intronic
1134044737 16:11092981-11093003 GTCGAGGCCCCCATGGAGCAGGG + Intronic
1134102504 16:11461966-11461988 CTGGGGGCTCACATGGAGCTTGG + Intronic
1136748727 16:32614561-32614583 GTGGAGGTCCACATGGAGAAAGG + Intergenic
1138438406 16:57019984-57020006 GTGCAGGCACAAATGGAGTAGGG + Intronic
1139563486 16:67758382-67758404 CAGGAGGCTCAAAAGGAGCTCGG - Intronic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1140005957 16:71075406-71075428 AAGGAGGCCCAAATGGAAGATGG + Intronic
1140953916 16:79845024-79845046 GGGGAGGCCAAAAGGGAGCAGGG + Intergenic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1203050861 16_KI270728v1_random:873775-873797 GTGGAGGTCCACATGGAGAAAGG + Intergenic
1145746765 17:27325626-27325648 CTGGAGGGCCAGCTGGATCATGG - Intergenic
1146669231 17:34725273-34725295 CTGGAGGCTCAAGAGGAGTAGGG + Intergenic
1146892192 17:36513456-36513478 GTCAATGCCCAAATGGAGCATGG + Exonic
1147443561 17:40461842-40461864 CAGGAGGGCCACATGGGGCAGGG - Intergenic
1147901064 17:43785150-43785172 CTGGAGACCCTGGTGGAGCAGGG + Exonic
1151890190 17:76947084-76947106 CAGGTGGCCCAGATGGAGCGTGG + Intronic
1152846891 17:82606206-82606228 CTTGGGGCCAAAGTGGAGCAGGG - Intronic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1160411553 18:78678506-78678528 CTGGAGCCCCAGAGGGGGCAGGG - Intergenic
1160663215 19:311094-311116 ATCGGGCCCCAAATGGAGCACGG + Intronic
1161454303 19:4362478-4362500 TTGGCGGTCCAGATGGAGCACGG + Intronic
1161615594 19:5268522-5268544 CAGGAGGCCAAGATGGGGCAAGG + Intronic
1162421239 19:10567269-10567291 CTGAAGGTCCTAGTGGAGCACGG - Exonic
1163446357 19:17348808-17348830 CTGGAGGCCCCAAGGAAGCGGGG - Intergenic
1164356207 19:27434029-27434051 CTTGAGGCCCATATTGAGAAAGG + Intergenic
1165722389 19:38088789-38088811 CTGGAAGACCACAAGGAGCACGG + Exonic
1166379474 19:42348366-42348388 CTGGAGGGCCAGGTGGACCAGGG + Exonic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167314385 19:48755290-48755312 CTGGAGCCCCTAAGGGTGCAAGG - Exonic
925428688 2:3772519-3772541 GAGGAGGACAAAATGGAGCACGG + Intronic
927328690 2:21836679-21836701 CTGGTGTCCCATATGGAGTATGG - Intergenic
927640101 2:24840709-24840731 CTGCAAGCCCACTTGGAGCAGGG + Intronic
928302864 2:30142114-30142136 GTGGAGGCCCAAATGTTCCAGGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929115002 2:38436570-38436592 CTAGACACCAAAATGGAGCAAGG - Intergenic
929958479 2:46478704-46478726 CTGAGGGCCTAAATGGAACAAGG + Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
933762313 2:85680786-85680808 CTGGAGGCCCCAAGGCAGCCAGG - Intergenic
936046676 2:109193959-109193981 CTGGTGCCCCAGAAGGAGCATGG - Intronic
937693140 2:124778948-124778970 CTGGAAGCCGAATTGGAGCATGG - Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
938902055 2:135806882-135806904 TTGCAGGGCCAGATGGAGCAGGG - Intronic
942249468 2:174035036-174035058 CTGAAGGCCCTACTGAAGCAAGG - Intergenic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
943953787 2:194161169-194161191 CTGGAGGACCCAATAGGGCAAGG - Intergenic
946195992 2:218033385-218033407 GTGGGGGCCCCACTGGAGCAAGG - Intergenic
946219174 2:218211631-218211653 CTGGAGGACTAACTGGAGAATGG + Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
947926500 2:233926393-233926415 ATGGTGGGCCGAATGGAGCATGG + Intronic
948124423 2:235554486-235554508 CAGCAGGCCCACATGCAGCAGGG - Intronic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948957268 2:241303271-241303293 CAGGAGCCCCAGATGGTGCAGGG + Intronic
1169248868 20:4045248-4045270 CTGAAGGCCTGAATAGAGCAAGG - Intergenic
1172299032 20:33835429-33835451 CTGGAGTCCCCAAAGGAGGAGGG - Intronic
1174386168 20:50189827-50189849 GTGGAGGCCCAGAGAGAGCATGG - Intergenic
1174497120 20:50955231-50955253 ATGGAAGCCCAGATGGAACAAGG - Exonic
1176736343 21:10550404-10550426 ATGGAAGCCCAAAGTGAGCAGGG + Intronic
1179436515 21:41366028-41366050 AGGGAAGCCCAAATGGAGAAAGG - Intronic
1179838436 21:44053744-44053766 CTGGAGGCACATGTGGAACAAGG - Intronic
1180954318 22:19734821-19734843 CAGGAGGACCATCTGGAGCACGG + Intergenic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182242348 22:28926045-28926067 CTGGAGGACCACCTGGGGCATGG + Intronic
1182349494 22:29691242-29691264 CTGGATTGCCAAAGGGAGCATGG + Intronic
1182551329 22:31102384-31102406 ATAGAGGCCCAGAAGGAGCAAGG + Intronic
1182985776 22:34714770-34714792 CTGGAGCCTCGAAGGGAGCATGG + Intergenic
1183548568 22:38468302-38468324 CTGGAGGTCCAAGTGCTGCAAGG + Exonic
1184070642 22:42144308-42144330 CTGGAAGTCCACATGCAGCAAGG + Intergenic
1184121257 22:42451927-42451949 CTGGAGGCACAAAACGGGCAAGG + Intergenic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
1185003297 22:48259854-48259876 CCAGAGGCCCAAAGGCAGCACGG + Intergenic
949420425 3:3859294-3859316 CTGCAGGCAGAAAAGGAGCAAGG - Intronic
950831275 3:15878437-15878459 CTGGAGGCCAAGATGCGGCATGG + Intergenic
951159038 3:19393515-19393537 CGGAAGTCCCAAATGGAGGAGGG - Intronic
952169249 3:30787709-30787731 CTTGAGGCCCAAGAGGAGCATGG - Intronic
953058721 3:39408978-39409000 CAGGAGGCCAAAGTGGAGAATGG + Intronic
953295541 3:41711858-41711880 ATGGAGGACCAAAAGAAGCATGG + Intronic
955303179 3:57803698-57803720 CTGGAGGCACAAATCCAACATGG + Intronic
956442550 3:69294661-69294683 CTGGAGGCCCAAAAGAGTCAGGG + Intronic
956705048 3:71992435-71992457 CTGGAGACCTAATTGGAGCTGGG + Intergenic
958856687 3:99393973-99393995 CTGCAGGCCCAAAGGGAACACGG + Intergenic
959562847 3:107802234-107802256 CTGGATGTCAAAAAGGAGCATGG - Intronic
960619077 3:119621894-119621916 CTGGAGGCCCCAAGGGAGCTAGG - Intronic
961334366 3:126161449-126161471 CAGGAGTCACAAAAGGAGCAAGG + Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
963179754 3:142341742-142341764 ATGGAAACCAAAATGGAGCAGGG + Intronic
965546270 3:169919552-169919574 TTGGAGGCCCAAATGGTGAGGGG - Exonic
968280313 3:197472120-197472142 CAGGAGGCCCAAATTCAGCAAGG + Intergenic
1202737737 3_GL000221v1_random:22824-22846 CTGGAGGCCCACATGCAGTGGGG - Intergenic
975723950 4:77274269-77274291 CTGGAGGCTCAACTGGATCCAGG - Intronic
979151198 4:117316840-117316862 CTGGTGGTCCAAAGGGAGCTTGG - Intergenic
982553337 4:156830448-156830470 CTGTAGGTCCACATGGAGAATGG - Intronic
984218417 4:176943336-176943358 CTGCAGGCTCCAGTGGAGCATGG - Intergenic
985990550 5:3556805-3556827 CTGGAGCCCCTCATGGAGCTTGG + Intergenic
987706690 5:21468346-21468368 CTGGAGGAAGAAATGCAGCACGG + Intergenic
988991147 5:36672158-36672180 CAGGAGCCCTAAATGGAGGAAGG + Intronic
995253300 5:110018607-110018629 CTGGAGGCCCCAGTGGTGGACGG - Intergenic
995723421 5:115161459-115161481 CTGATGGCCCAAATGCTGCATGG + Intronic
996352455 5:122560615-122560637 CTGGAGCCCCACATGGTGCAGGG - Intergenic
998848906 5:146336362-146336384 CTGGAAGCCCAAAGGGAAAAGGG - Intronic
999244261 5:150144894-150144916 TTGGAGGCCCAGATGGGGCCGGG - Intronic
1000348522 5:160334148-160334170 ATGGAGGACCCAATGGAGTAGGG - Intronic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1002382220 5:178839142-178839164 CTGGAGGCCCTGAAGTAGCAAGG + Intergenic
1004732131 6:18368224-18368246 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1005812587 6:29528815-29528837 CTGGAGGCTCAAAATGAGCAGGG - Intergenic
1006333118 6:33406203-33406225 CTGGCGGGCCAGATGAAGCAGGG - Exonic
1006387394 6:33738970-33738992 CTGAAGGCCCATCTAGAGCAGGG + Intronic
1007667641 6:43524846-43524868 CTGGAAGGCCAGATGGACCAGGG + Exonic
1009450400 6:63793089-63793111 GTTCTGGCCCAAATGGAGCATGG - Intronic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1015603524 6:134933392-134933414 CTGGACACCAAGATGGAGCAGGG - Intronic
1016668852 6:146676821-146676843 CTGGAGGCCCACTGTGAGCAAGG - Intronic
1017026284 6:150184244-150184266 TTTAAGGCACAAATGGAGCATGG + Intronic
1018790245 6:167142980-167143002 CTGGGGGCCCAAAGGCAGCAAGG - Intergenic
1021320772 7:19208135-19208157 TTGGAGTCCCATATGGAGCAGGG - Intergenic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1024711666 7:52021869-52021891 CAGGAGGCCTAGAGGGAGCAAGG - Intergenic
1024802133 7:53092269-53092291 CTGGAGGCCACAAATGAGCAAGG - Intergenic
1025810301 7:64871341-64871363 CTGTAGGCCCATGAGGAGCATGG - Intronic
1026346573 7:69479713-69479735 ATGGAGGACAAAATAGAGCAAGG + Intergenic
1027400163 7:77798689-77798711 CTGTGGGCCCAATGGGAGCACGG - Intergenic
1027648682 7:80837613-80837635 CCTGAGGCCAAAAAGGAGCAAGG - Intronic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1031336432 7:120538760-120538782 CAGGAGGCCGATATGGACCAGGG + Intronic
1032019691 7:128400451-128400473 CTGGAGGCCAAGATGCGGCATGG - Exonic
1032425141 7:131816537-131816559 CTGGAGGCCTAATTGGTGCCAGG - Intergenic
1033097021 7:138441090-138441112 CTGGAGGCCAAGATGCAGCATGG + Intergenic
1033947298 7:146736221-146736243 CTGGAGTTTCATATGGAGCAGGG + Intronic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1035743441 8:1945487-1945509 CTGGAGGCCCACCAGGAGGAAGG + Exonic
1036048128 8:5166729-5166751 CTGCAGGCCCAAATAGAAGATGG - Intergenic
1036581706 8:10081297-10081319 CAGGAGGCCCAAATGGCACGTGG - Intronic
1037813321 8:22099113-22099135 CTCGAGGACCAAGTGGAGCAGGG + Intronic
1038127305 8:24689140-24689162 CTGAAGGCCCCAATAGAACAAGG + Intergenic
1044522668 8:93217510-93217532 CCTGAGGCACAAAAGGAGCAGGG - Intergenic
1044776725 8:95697150-95697172 CTGTAGGCCCAAATGGTGGAGGG + Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1049302244 8:141877730-141877752 CTGGAGCCCCCAAAGCAGCAAGG - Intergenic
1052158563 9:25226411-25226433 CTGGAGTCCCAAAGGGTGGAGGG + Intergenic
1052941412 9:34134287-34134309 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1054361766 9:64128799-64128821 CTGGAGGCCCACATGCACTAGGG - Intergenic
1055794672 9:79962823-79962845 CTTGGGGCCAAAATGAAGCAGGG - Intergenic
1056886565 9:90448962-90448984 CTTGTTGCCCAACTGGAGCAAGG + Intergenic
1057183249 9:93040974-93040996 GAGGAGGCCCCAAGGGAGCAAGG - Intergenic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1057804814 9:98212460-98212482 TTGGGGGCCCAAAGGGAGGAAGG - Intronic
1059434205 9:114266579-114266601 CTGGAGGCCCAATTGGCCCCTGG - Exonic
1060112629 9:120917627-120917649 CTGGAGGCCCAAGGGGAGGATGG + Intronic
1062150612 9:135016930-135016952 CTGGGGGCCCAGATTGTGCAGGG + Intergenic
1062315898 9:135966900-135966922 CTGGAGGCCCCTCTGCAGCATGG - Intergenic
1062437278 9:136551884-136551906 CTGGTGCCCCAAGTGGAGCCTGG + Intergenic
1062453989 9:136627185-136627207 CAGGAAGCCCAGCTGGAGCACGG + Intergenic
1203706465 Un_KI270742v1:53268-53290 CTGGAGGCCCACATGCAGTGGGG - Intergenic
1188309247 X:28597064-28597086 AAGGAGGACCAAATGGAGCATGG + Intronic
1188630262 X:32348443-32348465 CTGGAGGCTGAAATTCAGCAGGG - Exonic
1189362047 X:40360314-40360336 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1189659239 X:43279232-43279254 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1189947732 X:46196253-46196275 CTGGAGGCCCAAATGCACTGTGG + Intergenic
1190159735 X:48022572-48022594 CTGGAACCCCAAAGGGAGCCAGG + Intronic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1192829952 X:74741174-74741196 CGGCAGGTCCAAATGGAGGATGG - Exonic
1194467732 X:94254853-94254875 CTGGAGGCCCCAGTGAAGGATGG - Intergenic
1195347162 X:103962537-103962559 CTGGAGGCTCAAGCGGAGGAGGG + Intronic
1195360280 X:104076304-104076326 CTGGAGGCTCAAGCGGAGGAGGG - Intergenic
1196820112 X:119694508-119694530 GAGGGGGCCCCAATGGAGCATGG + Intergenic
1196831049 X:119775834-119775856 CTGGAGGCCCACGAGGAGCTAGG - Intergenic
1197602244 X:128543865-128543887 CTTGAGAGCCACATGGAGCAGGG - Intergenic
1198028857 X:132735655-132735677 CTGGATGCCCACATGGAGCTGGG + Intronic
1200150570 X:153949436-153949458 CTGGAGGCCCTGCTGGTGCAGGG + Intronic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic