ID: 1190263427

View in Genome Browser
Species Human (GRCh38)
Location X:48813967-48813989
Sequence ATTTGGGCCTCCAGTGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190263419_1190263427 2 Left 1190263419 X:48813942-48813964 CCCGCAGCTAAGAGCCCCATGCT 0: 1
1: 0
2: 0
3: 14
4: 126
Right 1190263427 X:48813967-48813989 ATTTGGGCCTCCAGTGTCACAGG 0: 1
1: 0
2: 0
3: 10
4: 120
1190263418_1190263427 3 Left 1190263418 X:48813941-48813963 CCCCGCAGCTAAGAGCCCCATGC 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1190263427 X:48813967-48813989 ATTTGGGCCTCCAGTGTCACAGG 0: 1
1: 0
2: 0
3: 10
4: 120
1190263420_1190263427 1 Left 1190263420 X:48813943-48813965 CCGCAGCTAAGAGCCCCATGCTC 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1190263427 X:48813967-48813989 ATTTGGGCCTCCAGTGTCACAGG 0: 1
1: 0
2: 0
3: 10
4: 120
1190263417_1190263427 15 Left 1190263417 X:48813929-48813951 CCTTAGCTGGCTCCCCGCAGCTA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1190263427 X:48813967-48813989 ATTTGGGCCTCCAGTGTCACAGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190263427 Original CRISPR ATTTGGGCCTCCAGTGTCAC AGG Intronic
901329380 1:8393345-8393367 CTTTGGGCCCCCAGTCACACAGG - Intronic
902334543 1:15747471-15747493 CCTTGGGCCTCCAGTGACCCGGG - Intronic
902557713 1:17256686-17256708 CCTTGGGCCTCCAGTGTCCATGG - Intronic
907590999 1:55671077-55671099 ATTGTGGCATCCAATGTCACTGG - Intergenic
909542641 1:76807751-76807773 AGTTGGGCCCCCAGGGTCTCGGG - Intergenic
909825232 1:80119098-80119120 ATTGGGGCTTCCAGGTTCACAGG + Intergenic
915712233 1:157910946-157910968 AGTTGGGCCCCCAGTGCCTCAGG - Intergenic
918932608 1:190875018-190875040 ATTTGGGACTCCAGTGGAGCTGG - Intergenic
1066005681 10:31144291-31144313 ATTTGGCCCTCCTCTGTCGCCGG - Intergenic
1068453860 10:57230737-57230759 ATTTGGGCATCTAGTGACAGTGG + Intergenic
1069497567 10:68919833-68919855 ATTTGGCCATCCAGTGTCATTGG + Exonic
1070853323 10:79584943-79584965 CTCTGAGCCTCCAGAGTCACAGG + Intergenic
1074558988 10:114518259-114518281 AGTTGGGTCTATAGTGTCACTGG - Intronic
1074704400 10:116118383-116118405 ATTGGGGCCTCCTGTGTCAGAGG - Intronic
1077348157 11:2073905-2073927 CTTTGTGCCTCCTTTGTCACAGG + Intergenic
1081567510 11:44269178-44269200 CTTTGGGCATCCAGTGTAGCTGG + Intronic
1081632482 11:44699350-44699372 CATTGGGCCTGCAGTGGCACTGG + Intergenic
1082583897 11:54909955-54909977 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1088590992 11:111403077-111403099 ATGTGGGCCCCAAGAGTCACAGG + Intronic
1088846899 11:113675919-113675941 ATTTAAGCCTCCATTGTGACAGG - Intergenic
1089738129 11:120563917-120563939 GTTTAGGCCTGGAGTGTCACTGG - Intronic
1094397978 12:30029197-30029219 ACTTGGGCCTCCCAAGTCACTGG + Intergenic
1094857535 12:34417416-34417438 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1095192501 12:39273581-39273603 ATTTCGTATTCCAGTGTCACTGG - Intergenic
1100069550 12:90695603-90695625 ATTTTGCCCTCTAGTGTTACAGG - Intergenic
1100210701 12:92395645-92395667 ATCTCTGCCTCCATTGTCACTGG + Intergenic
1102507955 12:113395773-113395795 ATTTGGGCCTTCTGTGTAATGGG + Intronic
1103940041 12:124496474-124496496 ATGTGGGCCTCCAGTGGCGGAGG + Intronic
1107018565 13:35729006-35729028 ATTTGGGTCTCCAGTTTATCCGG + Intergenic
1108013439 13:46047945-46047967 ATTTTTCCCTCCACTGTCACTGG + Intronic
1108150352 13:47527358-47527380 AAATGTGCTTCCAGTGTCACGGG + Intergenic
1111836486 13:93394982-93395004 GTATTGGCCTCCACTGTCACAGG + Intronic
1118812909 14:69288453-69288475 ACATGGGCCTCCTGTGTCAATGG - Intronic
1120611530 14:86646945-86646967 ATTCTTGCCTCCAGTTTCACAGG - Intergenic
1121280526 14:92694235-92694257 ATATGAGACTCCAGTGTCAAAGG - Intergenic
1122890522 14:104730074-104730096 AGTTGGGCCTCCACAGGCACTGG - Exonic
1125626126 15:41110551-41110573 ATTTCGGCCTCCAGAGTAGCTGG + Intronic
1126846608 15:52766309-52766331 ACTTGGGCCTCCAGCTTCACTGG + Intronic
1126923229 15:53551193-53551215 ATTCTGACCTCCAGTCTCACTGG - Intronic
1128733144 15:70034347-70034369 CTCTGGGCCTCCAGGGTCTCAGG - Intergenic
1130681873 15:86004043-86004065 ATTTGGACATCCAGAGTCCCGGG - Intergenic
1134376290 16:13677792-13677814 ATGTGGGTCTCCAGTTTCCCAGG + Intergenic
1135248084 16:20874603-20874625 ATTTGGGCTTTCAGTTTCATGGG - Intronic
1137526878 16:49244273-49244295 ATTGGGGTCTGCAGTGGCACTGG + Intergenic
1139100802 16:63764135-63764157 ATGTGGTCCTCCAGTTTCTCAGG + Intergenic
1141551363 16:84808801-84808823 ATTTGGGATCCCAGTGTCCCAGG - Intergenic
1141756155 16:85992316-85992338 ATTTGGGGCTCCATTGCCAATGG + Intergenic
1148795507 17:50194900-50194922 GGCTGGGCCTCCAGTGTCAGGGG + Intronic
1152429696 17:80241855-80241877 CTGTGGGCCTCCAGGGTCCCAGG + Intronic
1152740047 17:82014831-82014853 ATTTGGGGCCCCAGTGTCCTGGG + Intronic
1154060503 18:11055701-11055723 ATTTGGGTCTCCAGTTGCAGTGG + Intronic
1157436196 18:47671445-47671467 ATGTGTGCCTCCAGTGTTACAGG - Intergenic
1157841720 18:50965468-50965490 ATTTTGGCCCCCAGTTTTACAGG - Intergenic
1158138127 18:54228133-54228155 GTTTTGGCCTCCTGTGTAACTGG + Intergenic
1158995865 18:62918589-62918611 ATTGGGGCCTGTGGTGTCACAGG + Intronic
1159745019 18:72222587-72222609 ATTTTTGCCTCTAATGTCACAGG + Intergenic
1161058079 19:2200555-2200577 CCTTGGGCCTCCAGGGTCCCTGG - Intronic
1164772908 19:30825878-30825900 AGCTGGTCCTCCTGTGTCACTGG + Intergenic
1164884872 19:31769978-31770000 AATTGGGCCTCCAGGGACACAGG - Intergenic
1167647563 19:50713922-50713944 GTCTGGGCCGCCAGTGTCAAGGG + Exonic
1167922801 19:52796058-52796080 ATTTCAGCCTCCAAAGTCACTGG - Intronic
927614990 2:24584613-24584635 ATTTGGGCCTATAGTGTGTCAGG + Intronic
928532089 2:32202891-32202913 ATTTGGCCATCCGGTGTCATTGG + Intronic
934529943 2:95079008-95079030 ACTTCAGCCTCCAGTGTAACTGG - Intergenic
934729026 2:96644749-96644771 ATTTGGGACTCCAGGCTCACAGG + Intergenic
938619722 2:133037574-133037596 ATTTGGATGTCCAGTTTCACCGG - Intronic
941438733 2:165506596-165506618 CTTTGGGCCTCCAGTCTGAGGGG + Intronic
943092466 2:183390736-183390758 TTTTGGGCCCCCAGTGACTCTGG - Intergenic
944987468 2:205193830-205193852 CTTTTCCCCTCCAGTGTCACAGG - Intronic
946664050 2:222031009-222031031 ATTTGGACCTCCACTGGGACTGG - Intergenic
948983488 2:241507043-241507065 AGTTGGGCCTGCAGTGGAACAGG - Intronic
1172768187 20:37362308-37362330 ATCTTGGCCTCCTGAGTCACTGG + Intronic
1178291309 21:31370967-31370989 AGTTTGGCCCCCAGTGTCCCAGG + Intronic
1183401708 22:37608879-37608901 ATTCGCGCCTCCAGAGTCTCCGG - Exonic
1184501912 22:44879554-44879576 ACTTGTGCCTCCAGGGCCACAGG - Intergenic
955570628 3:60301058-60301080 ATTTGGGCTTCCCGTTTCTCAGG + Intronic
956364362 3:68483819-68483841 ACTTCGGGCTCCAGTGACACTGG - Intronic
959087481 3:101866872-101866894 GTTTGGGCCTCCAGTGTTCCGGG + Intergenic
966391276 3:179455074-179455096 ATTTGTACCACCAGTGTCAGAGG - Intergenic
971859352 4:32085331-32085353 CTTTGTGGCTGCAGTGTCACTGG - Intergenic
973805146 4:54518547-54518569 AATTGGAGCTCCATTGTCACTGG - Intergenic
974561215 4:63521559-63521581 GTTTGGGCTTCCAGAGTCAGGGG + Intergenic
977858869 4:101931183-101931205 ATTTGGGCATCCTGTGGCCCAGG - Intronic
979680242 4:123451510-123451532 ATTTGGGTTTCCATTGTCATAGG + Intergenic
982185472 4:152792992-152793014 ATTTTGGCCTCCAATATAACTGG + Intronic
984081769 4:175255781-175255803 ACTTCAGCCTCCAGAGTCACTGG + Intergenic
985550980 5:533533-533555 CTCTGGGCCTCCAGGGTGACCGG - Intergenic
987009705 5:13749713-13749735 TTTTGGGCCACCTCTGTCACTGG - Intronic
991647770 5:68818521-68818543 ACTTGGGCCACCAGTGCCAGAGG + Intergenic
992582870 5:78200142-78200164 ATCTTTGCCTCCAGTGCCACAGG - Intronic
994067472 5:95559263-95559285 ATTTGGCCCTCCATATTCACAGG + Intronic
999691611 5:154150947-154150969 GTCTGGGCCTCCTTTGTCACCGG + Intronic
1005636646 6:27759238-27759260 GATTGGGCCTACAATGTCACTGG + Intergenic
1005986130 6:30876611-30876633 ATTTGGGCCACCAGTGTTCTTGG + Intronic
1006984561 6:38168166-38168188 ATTTGGGCCAGCACTGTCACCGG - Intergenic
1009537540 6:64908338-64908360 CTCTGGGGCTTCAGTGTCACAGG - Intronic
1014413808 6:121158712-121158734 ATTTTTGCCTTAAGTGTCACAGG + Intronic
1014619577 6:123649101-123649123 ACTTGGGCTTCCTTTGTCACTGG - Intergenic
1016155870 6:140808322-140808344 ATTTGGGCTTCGGGAGTCACAGG - Intergenic
1017281018 6:152625989-152626011 AATAGGGCATCCACTGTCACAGG + Intronic
1019743090 7:2684797-2684819 ATCTGGGCTTCCAGTCTCCCGGG + Intronic
1020232888 7:6333611-6333633 AATTCAGCCTCCTGTGTCACTGG + Intronic
1021049705 7:15967558-15967580 ATTTTCTCCTCCATTGTCACTGG - Intergenic
1022013329 7:26328156-26328178 CTCTCAGCCTCCAGTGTCACTGG - Intronic
1022980633 7:35601858-35601880 CTTTGGGGCTTCAGGGTCACTGG - Intergenic
1023840684 7:44096033-44096055 ATTGGGACCTGCAGGGTCACAGG - Intergenic
1024362516 7:48483108-48483130 ATTTGCACCTCCAGCTTCACTGG - Exonic
1025592086 7:62873970-62873992 ATTTGGGCCTACAGTGAGAAAGG + Intergenic
1029279113 7:99425325-99425347 ACTTGGGCCTCCAGAGCCTCCGG - Exonic
1029887812 7:103891397-103891419 AATTGGGCCTCCTGCTTCACAGG - Intronic
1032387620 7:131535414-131535436 GTTTGGGACACCAGTGTGACTGG + Intronic
1033286393 7:140044408-140044430 ATCTCAGCCTCCATTGTCACAGG - Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1044302577 8:90603129-90603151 ATTTGAGCCTCTTTTGTCACTGG + Intergenic
1045999815 8:108406181-108406203 AATTGTGCCTCCATTGTCTCAGG + Intronic
1047790315 8:128197025-128197047 CATTGAGCCTCTAGTGTCACAGG + Intergenic
1049343992 8:142128779-142128801 GTTTGGGCTTCATGTGTCACTGG - Intergenic
1052158558 9:25226402-25226424 CTTTGGGACTCCAGAGTTACTGG - Intergenic
1052581553 9:30362196-30362218 TTATAGACCTCCAGTGTCACAGG + Intergenic
1053268002 9:36729872-36729894 CTTTGGGCCTCCAGAGATACGGG + Intergenic
1055115729 9:72603226-72603248 GTTTGGGCCTTCAGTGACTCCGG - Intronic
1055379190 9:75687799-75687821 AAATGAGCCACCAGTGTCACTGG - Intergenic
1056137690 9:83646298-83646320 CTCTTGGCCTCCAGGGTCACTGG - Intergenic
1057019879 9:91688962-91688984 GTTTGGGCCTCTTGAGTCACTGG + Intronic
1062539764 9:137036356-137036378 ATTGGGGTCTCCAGAGTCCCTGG + Exonic
1188470179 X:30529393-30529415 TTTTTGGCATCCAGTGTCAAAGG - Intergenic
1188661392 X:32763390-32763412 ATTTTGGCCTACAGGGTCACAGG - Intronic
1190263427 X:48813967-48813989 ATTTGGGCCTCCAGTGTCACAGG + Intronic
1192562373 X:72135601-72135623 ATGGGGTCCTCCACTGTCACTGG + Intronic
1196948840 X:120855543-120855565 ATTTCTGTCTCCTGTGTCACTGG + Intergenic
1198129611 X:133680497-133680519 ATTTGTAACTCCAGTGTCACAGG - Intronic