ID: 1190265921

View in Genome Browser
Species Human (GRCh38)
Location X:48827100-48827122
Sequence GCGCAGGGAGGCCGCGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190265921_1190265933 23 Left 1190265921 X:48827100-48827122 CCAGGGCCGCGGCCTCCCTGCGC No data
Right 1190265933 X:48827146-48827168 GCCCCGTCCCGCCAGGCACCTGG No data
1190265921_1190265931 1 Left 1190265921 X:48827100-48827122 CCAGGGCCGCGGCCTCCCTGCGC No data
Right 1190265931 X:48827124-48827146 TCGCGGGGACTGGGCGAGTGTGG No data
1190265921_1190265939 28 Left 1190265921 X:48827100-48827122 CCAGGGCCGCGGCCTCCCTGCGC No data
Right 1190265939 X:48827151-48827173 GTCCCGCCAGGCACCTGGGGTGG No data
1190265921_1190265927 -9 Left 1190265921 X:48827100-48827122 CCAGGGCCGCGGCCTCCCTGCGC No data
Right 1190265927 X:48827114-48827136 TCCCTGCGCGTCGCGGGGACTGG No data
1190265921_1190265932 16 Left 1190265921 X:48827100-48827122 CCAGGGCCGCGGCCTCCCTGCGC No data
Right 1190265932 X:48827139-48827161 GAGTGTGGCCCCGTCCCGCCAGG No data
1190265921_1190265935 24 Left 1190265921 X:48827100-48827122 CCAGGGCCGCGGCCTCCCTGCGC No data
Right 1190265935 X:48827147-48827169 CCCCGTCCCGCCAGGCACCTGGG No data
1190265921_1190265929 -8 Left 1190265921 X:48827100-48827122 CCAGGGCCGCGGCCTCCCTGCGC No data
Right 1190265929 X:48827115-48827137 CCCTGCGCGTCGCGGGGACTGGG No data
1190265921_1190265937 25 Left 1190265921 X:48827100-48827122 CCAGGGCCGCGGCCTCCCTGCGC No data
Right 1190265937 X:48827148-48827170 CCCGTCCCGCCAGGCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190265921 Original CRISPR GCGCAGGGAGGCCGCGGCCC TGG (reversed) Intergenic
No off target data available for this crispr