ID: 1190267286

View in Genome Browser
Species Human (GRCh38)
Location X:48835155-48835177
Sequence CCGGGCACGGAGAGGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 338}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190267274_1190267286 20 Left 1190267274 X:48835112-48835134 CCTTTCTTAAAGCGCCTTAGTGC 0: 1
1: 0
2: 1
3: 2
4: 47
Right 1190267286 X:48835155-48835177 CCGGGCACGGAGAGGTGGGCAGG 0: 1
1: 0
2: 2
3: 47
4: 338
1190267276_1190267286 6 Left 1190267276 X:48835126-48835148 CCTTAGTGCCGTGGACAGCGTCA 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1190267286 X:48835155-48835177 CCGGGCACGGAGAGGTGGGCAGG 0: 1
1: 0
2: 2
3: 47
4: 338
1190267278_1190267286 -2 Left 1190267278 X:48835134-48835156 CCGTGGACAGCGTCACAGGCACC 0: 1
1: 0
2: 0
3: 6
4: 141
Right 1190267286 X:48835155-48835177 CCGGGCACGGAGAGGTGGGCAGG 0: 1
1: 0
2: 2
3: 47
4: 338
1190267273_1190267286 21 Left 1190267273 X:48835111-48835133 CCCTTTCTTAAAGCGCCTTAGTG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1190267286 X:48835155-48835177 CCGGGCACGGAGAGGTGGGCAGG 0: 1
1: 0
2: 2
3: 47
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190267286 Original CRISPR CCGGGCACGGAGAGGTGGGC AGG Intronic
900163638 1:1236176-1236198 CCGGGCACAGGGAACTGGGCTGG - Intergenic
900342637 1:2195956-2195978 CCGGGCAGGGGGAGGGGGCCTGG + Intronic
900414422 1:2528517-2528539 AGGGGCAGGGGGAGGTGGGCTGG - Intergenic
900716426 1:4147970-4147992 CCGGGGAAGACGAGGTGGGCAGG + Intergenic
900808214 1:4781759-4781781 CCGGGCATGGCCAGGTGAGCTGG - Intronic
901054093 1:6440594-6440616 ACGGGCGGGGAGAGGGGGGCGGG - Intronic
901667571 1:10835373-10835395 CCGGGCAAGGGGAGGCGGGCAGG + Intergenic
901750033 1:11400402-11400424 CTGGACAGGGAGAGGTGGGACGG + Intergenic
902049904 1:13554998-13555020 CCGGGCACGGGGCGGGAGGCGGG - Intergenic
902232426 1:15036378-15036400 CAGGGCAGGGGGAGCTGGGCAGG - Intronic
903830034 1:26169242-26169264 CTGGGCTCCCAGAGGTGGGCTGG - Intergenic
904586626 1:31584391-31584413 CCAGGCACAGAGAAGTGGCCAGG - Intronic
904593490 1:31628356-31628378 CCGTCCACAGAGAGCTGGGCTGG - Intronic
904877561 1:33668186-33668208 CTGGGCCAGGAGAGGTAGGCAGG + Intronic
905132235 1:35769785-35769807 CCGGGCACCGAGAGGTTAGGTGG - Intronic
905772768 1:40649016-40649038 CCACTCAGGGAGAGGTGGGCGGG + Intronic
906532106 1:46529885-46529907 CCGGGCATGGTGGGGTGTGCTGG + Intergenic
906802437 1:48749784-48749806 CTGGGCACAGATAGTTGGGCAGG - Intronic
907243644 1:53093920-53093942 CAGGGCACAGTGAGATGGGCAGG - Intronic
910750236 1:90621199-90621221 CCAGTCACGGAAAGGAGGGCTGG + Intergenic
912818617 1:112849705-112849727 CGTGGCACGGAGAGGCGGGGCGG + Intergenic
914790758 1:150875971-150875993 CCGGGGACGGAGACGGGGACGGG + Intronic
915319888 1:155050992-155051014 CCTGGCTCGGAGAGGTCGGGCGG - Intronic
920442335 1:205989411-205989433 CCTGGCAAGGTGAGGAGGGCGGG - Intronic
920966276 1:210704060-210704082 CAGGGCAAGGAGAGGTGCCCTGG + Intronic
922606421 1:226892474-226892496 CCTGGCACGCAGCAGTGGGCTGG - Intronic
922730474 1:227946726-227946748 CCGGGCAGGGAGAGGCCGCCTGG - Intronic
922915746 1:229256215-229256237 TTGGGCATGGTGAGGTGGGCAGG + Intergenic
924553247 1:245097905-245097927 ATGAGGACGGAGAGGTGGGCAGG + Intronic
1062850731 10:740613-740635 CGGGGCTGGGGGAGGTGGGCAGG - Intergenic
1062995202 10:1859065-1859087 CAGGGCACAGAGGGGCGGGCTGG + Intergenic
1066654510 10:37685851-37685873 CAGGCCAGGGAGAGGTGGACAGG + Intergenic
1067812865 10:49444058-49444080 GCTGGCAAGGAGAGGTGTGCTGG + Intergenic
1068954156 10:62806029-62806051 CCGGGCACGGTTATGGGGGCGGG + Exonic
1069719733 10:70541737-70541759 CCGGCTATGGAGATGTGGGCTGG + Intronic
1070626395 10:78054147-78054169 CTGGGCAGGCAGAGGAGGGCTGG + Intronic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1075001903 10:118804888-118804910 CTGGGGAGGGAGAGGTGGGCAGG + Intergenic
1076291355 10:129348432-129348454 CCCGGCTCGGAGGGGTGGACTGG - Intergenic
1076291399 10:129348584-129348606 CCTGGCTCGGAGGGGTGGACTGG - Intergenic
1076522107 10:131087807-131087829 CCAGGCAGAGAGAGGTGGCCGGG + Intergenic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076857514 10:133124538-133124560 CTGGGCACAGAGGGGTGGGGTGG + Intronic
1076881163 10:133239847-133239869 CCGGGCAGGCTGGGGTGGGCAGG + Intronic
1077011546 11:381320-381342 CCGGGGGCGGAGAGGTGGTCAGG - Intronic
1077011561 11:381352-381374 CCGGGGGCGGAGAGGTGGTCAGG - Intronic
1077011575 11:381384-381406 CCGGGGGCGGAGAGGTGGTCAGG - Intronic
1077011590 11:381416-381438 CCGGGGGCGGAGAGGTGGTCAGG - Intronic
1077011604 11:381448-381470 CCGGGGGCGGAGAGGTGGTCAGG - Intronic
1077011619 11:381480-381502 CCGGGGGCGGAGAGGTGGTCAGG - Intronic
1077011633 11:381512-381534 CCGGGGGCGGAGAGGTGGTCAGG - Intronic
1077011648 11:381544-381566 CCGGGGGCGGAGAGGTGGTCAGG - Intronic
1077011662 11:381576-381598 CCGGGGGCGGAGAGGTGGTCAGG - Intronic
1077011677 11:381608-381630 TTGGGGACGGAGAGGTGGTCAGG - Intronic
1077011690 11:381640-381662 CCGGGGGCAGAGAGGTGGTCAGG - Intronic
1078086231 11:8234429-8234451 CTGGGCTGGGACAGGTGGGCAGG - Intronic
1078594520 11:12674751-12674773 CCGGGCACCGAGCAGAGGGCGGG + Exonic
1079334708 11:19561310-19561332 CCAGTCACGGAGAGTCGGGCGGG + Intronic
1082723654 11:56709560-56709582 CCTGTCAGGGAGTGGTGGGCTGG - Intergenic
1083378039 11:62242146-62242168 CCTGGGAAGGAGAGGTGGGCTGG + Intergenic
1084380379 11:68808056-68808078 CCGGGGACGCACAGGTCGGCAGG - Intronic
1084633795 11:70376129-70376151 CCGGGCACGGTGGCGTGTGCCGG - Intronic
1085416470 11:76321964-76321986 CCGCGCGCAGAAAGGTGGGCCGG + Intergenic
1087252137 11:95914395-95914417 CAGGGCAGGGAGTGGTGGGGAGG + Intronic
1088764736 11:112963513-112963535 CAGGGCCCGGAGAGGAGGGGTGG + Intronic
1089775322 11:120831758-120831780 GAAGGCACGGAGATGTGGGCTGG - Intronic
1091301634 11:134511515-134511537 CTGGGCACAGAGAGGTGGAGTGG - Intergenic
1091633999 12:2183649-2183671 GCGGGCACAGAGAGTGGGGCTGG + Intronic
1091649422 12:2298840-2298862 CCAGGCACAGAAGGGTGGGCTGG - Intronic
1092203748 12:6603271-6603293 CTGGGCAAGGATAGGTGGGAAGG + Intronic
1092236977 12:6816413-6816435 CAGGCCAGGGAGGGGTGGGCAGG + Intronic
1094480173 12:30875170-30875192 CCAGGCAGGGAGGGGAGGGCTGG + Intergenic
1095465226 12:42482994-42483016 CCGGGGACGCAGAGAGGGGCTGG - Intronic
1095672405 12:44876354-44876376 CCGGGGAGGGAGGGGCGGGCCGG + Intronic
1101467236 12:104960456-104960478 CCTGGGAGGGAGAGGTGGGCGGG + Intergenic
1102904450 12:116663332-116663354 CAGAGCAGGGAGAGGTGGGGAGG - Intergenic
1104602476 12:130162770-130162792 CCGGGCGCGGAGAGCCGAGCCGG + Exonic
1104894975 12:132159579-132159601 CAGGGCATGGAGATGTGGGCGGG + Intergenic
1104988534 12:132611214-132611236 CCGGGCACGGGGAGGAGGGGCGG + Intergenic
1105024345 12:132838463-132838485 CAGCACACGGAGGGGTGGGCAGG + Intronic
1105804800 13:23946684-23946706 CTGGGCACTGAGAGCTGGGCTGG - Intergenic
1106306617 13:28516850-28516872 CCGGGCATGGTGATGTGTGCCGG + Intergenic
1107448263 13:40486893-40486915 CCAGGCCCAGAGAGATGGGCTGG + Intergenic
1108541595 13:51452044-51452066 CCGGGCACGGAGCTGCGGGACGG + Exonic
1113000485 13:105630366-105630388 CCTGGGACAGAGAGGTGGGTGGG - Intergenic
1113582828 13:111440794-111440816 GCGGGGATGGAGAGGTGGGAAGG - Intergenic
1113907559 13:113826854-113826876 CGGGGCAGGGATGGGTGGGCGGG - Intronic
1114614866 14:24062937-24062959 CCAGGCACAGTGAGGTGGCCAGG - Intronic
1118550532 14:66944885-66944907 CCTGGCAGGGAGAGGAGTGCAGG + Intronic
1119258370 14:73219801-73219823 TGGGGAATGGAGAGGTGGGCAGG + Exonic
1119738825 14:77000737-77000759 CCGGGCAGGGCGAGCTGAGCGGG - Intergenic
1120781573 14:88490458-88490480 CAGGGCAGGAAGAGGTGGGAGGG - Intronic
1120977383 14:90261088-90261110 CTGAGGTCGGAGAGGTGGGCTGG - Intronic
1121525114 14:94614184-94614206 CCGGGCACAGAGCGGTGAGGGGG - Exonic
1122075351 14:99231729-99231751 ATGGGCTCGGGGAGGTGGGCAGG + Intronic
1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG + Intergenic
1122852815 14:104546132-104546154 GCGGGCACCCGGAGGTGGGCAGG - Intronic
1123033707 14:105463264-105463286 CCGGGCACTGAGTGGCGGGCGGG - Intronic
1123037422 14:105477185-105477207 CCAGGCAGGAAGAGGTGGGGAGG - Intronic
1202902811 14_GL000194v1_random:53031-53053 CTGGGCACTGAGAGCTGGGCTGG + Intergenic
1202853983 14_GL000225v1_random:38258-38280 AAGGGCACGGAGAGGTCAGCGGG - Intergenic
1128089771 15:64911716-64911738 TCGGGCGCGGAGGGGTGGGCAGG + Intronic
1128218920 15:65953968-65953990 CCGGGCAGGGAGAGCTGGGGTGG + Intronic
1128498418 15:68210994-68211016 GCGGGCACTGAGGGCTGGGCGGG + Intronic
1128743371 15:70097731-70097753 CGGGGCGCGGAGAGGAGAGCCGG - Exonic
1130051460 15:80487247-80487269 CAAGGCACGGGGAGGTGGGCAGG - Intronic
1130224571 15:82047053-82047075 CGGGGCACGGAGGGGAGGGATGG - Intergenic
1131278186 15:90999852-90999874 GCTGGCAGTGAGAGGTGGGCTGG - Intronic
1131714812 15:95096853-95096875 CCGTCCGCGGAGAGGAGGGCTGG - Intergenic
1132014074 15:98300472-98300494 CGGGGCGCGGGGAGGTGAGCAGG - Intergenic
1132395531 15:101470978-101471000 CCTGGCACGGCAAGGTAGGCTGG - Intronic
1132496758 16:266958-266980 CTGGCCATGGAGGGGTGGGCAGG + Intronic
1132561414 16:596233-596255 CGGGGAGCTGAGAGGTGGGCGGG + Intronic
1132639335 16:970633-970655 CCGGGCAAGGCGGGGCGGGCAGG - Intronic
1132666446 16:1083237-1083259 CCGGGCAGGACGAGGAGGGCGGG + Intergenic
1132690942 16:1181535-1181557 GCAGGCACGGAGAGGAGGGCTGG + Intronic
1132739476 16:1404302-1404324 CTGTGCACAGTGAGGTGGGCGGG - Intronic
1132873982 16:2127901-2127923 CCAGGGAGGGAGAGGTGGGAGGG + Intronic
1133058326 16:3158552-3158574 CCCAGCACCGAGAGGAGGGCCGG - Intergenic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1134553069 16:15147075-15147097 CCAGGGAGGGAGAGGTGGGAGGG + Intergenic
1136893393 16:33982991-33983013 CAGAGCCTGGAGAGGTGGGCAGG - Intergenic
1138201712 16:55093431-55093453 CCAGCCACAGAGGGGTGGGCAGG + Intergenic
1140519170 16:75566796-75566818 CCGGGAACCGACCGGTGGGCAGG + Intronic
1141586437 16:85036751-85036773 CCGGGCAGGGGGTGCTGGGCTGG - Intronic
1141615152 16:85206157-85206179 CCGGGCACGGGAAGGGGGGAGGG + Intergenic
1141720475 16:85752640-85752662 CAGGGCAGGGACAGCTGGGCTGG - Intergenic
1141912144 16:87067318-87067340 TAGGACCCGGAGAGGTGGGCGGG - Intergenic
1142206914 16:88787670-88787692 CCAGCCAGGGAGAGGTGGGGCGG + Intergenic
1142281860 16:89153019-89153041 ACGGGCAGGGGCAGGTGGGCAGG + Intronic
1142405157 16:89884399-89884421 AGGGGCTCGGAGAGGTGGGAAGG + Intronic
1203079644 16_KI270728v1_random:1140631-1140653 CAGAGCCTGGAGAGGTGGGCAGG + Intergenic
1142594009 17:1020880-1020902 CCGAGCACGGGGAGCTGGCCGGG - Intronic
1142683141 17:1562089-1562111 CAGGGCAGGGAGAGCTGGCCCGG - Intronic
1142683233 17:1562334-1562356 CGGGGCACGGAGGGGCGGCCGGG - Intronic
1142692731 17:1616708-1616730 CGGGGCACGAGGAGGTGAGCTGG - Exonic
1142697825 17:1643410-1643432 CGGGGCGGGGACAGGTGGGCTGG - Intronic
1144766971 17:17738279-17738301 GCGGGCACTGAGGGGTGGGCTGG + Intronic
1147580682 17:41625631-41625653 CCGGGCTTGGGGTGGTGGGCAGG - Intergenic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147591887 17:41689117-41689139 CCGGGCCCGGAGACGTGTTCCGG + Intronic
1147738881 17:42659228-42659250 GCAGGCGCGGAGCGGTGGGCAGG + Intergenic
1147967344 17:44200184-44200206 ACGGGGGCGGAGAGATGGGCGGG + Intergenic
1148052912 17:44777917-44777939 CAGGGCCAGGAGAGGTGAGCAGG - Intronic
1148337411 17:46851293-46851315 CCGGGCCTGGAGAGGCGGGGAGG - Intronic
1148650904 17:49249453-49249475 GCAGGCAAGGAGGGGTGGGCAGG + Intergenic
1148776219 17:50096952-50096974 CCAGGCTGGGTGAGGTGGGCTGG + Intronic
1151386106 17:73756463-73756485 CCAGGCATGGACAGGAGGGCAGG - Intergenic
1152045402 17:77931700-77931722 CCAGGCCCTGAGGGGTGGGCTGG + Intergenic
1152231258 17:79115220-79115242 CCGGGCACCTAGGGGTGGGGTGG - Intronic
1152357285 17:79813356-79813378 GCGGGCACCGAGAGCGGGGCTGG + Intergenic
1152390528 17:80001482-80001504 CTGGGCCCGGAGGGGTGGGCGGG + Intronic
1152610225 17:81311686-81311708 GAGGGCAGGGAGAGGTGGGGTGG + Exonic
1152705819 17:81843111-81843133 CCAAGCCCGGAGAGCTGGGCTGG - Intergenic
1155070152 18:22307856-22307878 AAGGCCACGGGGAGGTGGGCAGG + Intergenic
1156275776 18:35581663-35581685 CCGGGCGCGGAGGCGGGGGCGGG + Intronic
1157384073 18:47247537-47247559 CCCGGCAGGAGGAGGTGGGCCGG + Intronic
1158546595 18:58403117-58403139 CGGGGCACTGTGAAGTGGGCTGG - Intergenic
1159971989 18:74666328-74666350 CCGGGGACAGAGAAGTGGGTGGG + Intronic
1160163204 18:76491263-76491285 CCGGGGCCGGGGAGGGGGGCGGG - Intronic
1160744239 19:703400-703422 TGGGGCAAGGAGAGGTGAGCAGG + Intergenic
1160774480 19:848695-848717 CAGGGGACGGGGAGGAGGGCAGG + Intergenic
1160949605 19:1659068-1659090 GCGGAGACGGGGAGGTGGGCAGG - Intergenic
1161064169 19:2229377-2229399 CCGGGCAAGGAGAGGAGGACTGG + Intronic
1161153298 19:2720643-2720665 CCGGGCACGGCGTGGTTGGTGGG + Intronic
1161210423 19:3062609-3062631 CGGGCCACGGGGAGGCGGGCCGG - Intronic
1161306795 19:3573175-3573197 CCGGGCCCGGAGCGCTGGGGGGG - Intronic
1161565079 19:4997422-4997444 CTGGGGGCGGCGAGGTGGGCTGG + Intronic
1161613735 19:5258016-5258038 CCTCGCACGTAGAGGTTGGCAGG + Exonic
1162030331 19:7914502-7914524 CCTGGCAGGGCGAGGTGGGAAGG + Intergenic
1162031548 19:7919664-7919686 CCGGGTAAGGAGAGGAGGGAGGG - Intergenic
1162183062 19:8883710-8883732 CAGGGCAGAGTGAGGTGGGCAGG + Intronic
1162894793 19:13758846-13758868 CCTGGGAGGGAGCGGTGGGCAGG - Exonic
1163154515 19:15432578-15432600 CCGGGCTCGGGGGGCTGGGCGGG + Intronic
1163305061 19:16472459-16472481 CGGGGCAGGGTGAGGGGGGCAGG - Intergenic
1163509887 19:17728068-17728090 CCGGGCACTGAGTGGTCGGCTGG - Exonic
1163527974 19:17832776-17832798 CTGGGCAAGGTAAGGTGGGCAGG - Exonic
1163720591 19:18896419-18896441 ACGGGCACGGCGCGGTGGGGTGG - Intronic
1164137075 19:22425789-22425811 CCTGGGACGGCCAGGTGGGCAGG + Intronic
1165394600 19:35557576-35557598 CTGGGCCGGGAGTGGTGGGCAGG + Intronic
1165846569 19:38821579-38821601 CCGCACTCGGAGTGGTGGGCCGG + Intronic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166694779 19:44846352-44846374 CCGGGCGGGGAGAGCTGGGCCGG + Intronic
1166802986 19:45469455-45469477 CCGGGGACAGAGAGGGGGGAAGG - Intronic
1166812497 19:45522585-45522607 AGGGGCCGGGAGAGGTGGGCAGG + Intronic
1167075141 19:47244019-47244041 CGGGGAAGGGAGAGGGGGGCGGG - Intergenic
1167258790 19:48446090-48446112 CCGGGCAGGTAGACCTGGGCCGG - Exonic
1168330404 19:55564488-55564510 CCGGGCAGGGGGAGGTGCCCGGG + Intergenic
925405403 2:3602749-3602771 CAGTGCGGGGAGAGGTGGGCTGG - Intronic
925942917 2:8837384-8837406 CCGGGCTCGGGGAGTCGGGCGGG - Intronic
926821440 2:16855352-16855374 CCTGGCCCGGAGGGGTGGGGAGG - Intergenic
927863871 2:26576649-26576671 CAGGGCAGGGAGGGGTGAGCAGG - Intronic
927878131 2:26672515-26672537 TTGGGCACAGGGAGGTGGGCTGG - Intergenic
928112492 2:28521990-28522012 CTGTGCATGGAGTGGTGGGCTGG - Intronic
930769819 2:55120070-55120092 CACGGCACTGAGAGGTGGGGTGG + Intergenic
931516305 2:63052308-63052330 CTGGGCACAGAGAGGTCAGCTGG + Intronic
931710882 2:64988807-64988829 CCGGGCGCGGTGAGGGGGCCCGG - Intronic
932591117 2:73068346-73068368 CAGGACACAGAGATGTGGGCTGG + Intronic
933782273 2:85811012-85811034 CCTGGCAGGGAGAGGGGTGCTGG + Intergenic
934079002 2:88452143-88452165 CGGGGCCCGGGGAGCTGGGCTGG - Exonic
934503850 2:94877364-94877386 GTGGGCACTGAGAGCTGGGCTGG - Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
937039994 2:118813726-118813748 CCAGGGACAGAGAGGTGAGCAGG + Intergenic
937320945 2:120960380-120960402 GCGAGCAGGGAGAGGTGGGTGGG + Intronic
937907157 2:127058011-127058033 GCGGGAAGGGAGAGGTGGGCAGG - Intronic
938315021 2:130319164-130319186 CTGGGCACTGAGAACTGGGCGGG - Intergenic
938698352 2:133854691-133854713 CTGGTCCCGGAGAAGTGGGCAGG - Intergenic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
941808620 2:169734142-169734164 CCGGGCGCGGGGAGCGGGGCCGG + Intronic
943712445 2:191111975-191111997 CAGAGCACGGAGAGGTAGGAGGG + Intronic
943724501 2:191238910-191238932 CCAGTCACTGAGAGGGGGGCTGG + Intergenic
946386657 2:219387947-219387969 AGGGGCGGGGAGAGGTGGGCGGG - Exonic
947860426 2:233354299-233354321 CACGGCCCGGAGAGGTGGGCGGG + Intergenic
947991886 2:234495329-234495351 GCGGGCACGGAGCGCTGTGCTGG - Exonic
948319783 2:237060112-237060134 CCTGGCTGGGAGAGGTGGGTAGG + Intergenic
948514707 2:238496852-238496874 CAGGGCAAGGAGGGCTGGGCGGG + Intergenic
948550258 2:238766142-238766164 CTGGGCAGGGGGAGGTGGTCAGG - Intergenic
948624614 2:239261443-239261465 CTGGGCTCTGGGAGGTGGGCAGG + Intronic
948787384 2:240359570-240359592 CCAGGCCCGGAGGGGAGGGCAGG - Intergenic
949009801 2:241671975-241671997 CAGGGCAGGGTGAGGAGGGCAGG - Intronic
949072936 2:242036993-242037015 CGGGGCTGGGAGAGGTGGGATGG + Intergenic
1169135556 20:3195114-3195136 CCAGGCAGTGAGAGGTGGGTGGG - Intronic
1169571682 20:6913188-6913210 TCTGGCACTGAGAGGTGGGGGGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171456915 20:25277370-25277392 TCTGGCATAGAGAGGTGGGCTGG + Intronic
1171462718 20:25308059-25308081 CAGGGAACTGAGAGGTAGGCAGG + Intronic
1172028048 20:31962877-31962899 GCTGGCAGGGAGGGGTGGGCAGG - Intergenic
1172241013 20:33412481-33412503 CAGGGCAGGGTGAGGTGGCCAGG + Intronic
1173740268 20:45395274-45395296 CCAGGCATGGAGTGGTGGGGGGG - Intronic
1173823334 20:46032083-46032105 CCGGGCCAGGAGATGAGGGCAGG - Intronic
1174292879 20:49521444-49521466 CAGGGCCAGGAGAGCTGGGCAGG - Intronic
1174394498 20:50238307-50238329 CGAGGCACAGAGAGGTTGGCCGG - Intergenic
1174517467 20:51103598-51103620 CCTGGAAAGGAGAGATGGGCTGG - Intergenic
1175256763 20:57652496-57652518 GCAGGTACGGATAGGTGGGCTGG + Exonic
1175840288 20:62022261-62022283 CCAAGCATGGAGAGGTGGGAAGG + Intronic
1175895528 20:62334110-62334132 GCTGGCAGGGAGGGGTGGGCAGG - Intronic
1175898886 20:62352233-62352255 TGGAGAACGGAGAGGTGGGCCGG - Exonic
1175996443 20:62814177-62814199 CCAGGCATGAACAGGTGGGCAGG + Intergenic
1176023731 20:62975386-62975408 CCCGGCAGGGAGTGCTGGGCAGG + Intergenic
1176054103 20:63135150-63135172 CAGGGCCCGGAGAGGTGGCAGGG + Intergenic
1176054110 20:63135168-63135190 CAGGGCCCGGAGAGGTGGCAGGG + Intergenic
1176168130 20:63685220-63685242 AGGGGCACAGAGAGGAGGGCTGG + Intronic
1176622177 21:9067798-9067820 CTGGGCACTGAGAGCTGGGCTGG + Intergenic
1178258856 21:31080174-31080196 CAGGGTAGAGAGAGGTGGGCTGG + Intergenic
1179054167 21:37916186-37916208 CCGAGCGCGGAGAGCAGGGCTGG + Exonic
1179955211 21:44734658-44734680 CCCGGCACGGGGGGGTGGGTGGG - Intergenic
1180200419 21:46220749-46220771 CCGGGCATGGAGAGGTAGCCAGG + Intronic
1180214109 21:46313943-46313965 CCAGGCACCCAGAGGTGGGATGG - Intronic
1180324808 22:11360951-11360973 CCGGGCTGGAAGAGGTGGGCAGG - Intergenic
1180621400 22:17164933-17164955 CAGGCCACAGAGAGATGGGCAGG + Intronic
1181316603 22:21974638-21974660 TTGGGCACTGAGAGGTGGGACGG + Intronic
1182520463 22:30881813-30881835 CCGGGCTGGGGGAGGTGGACGGG + Intronic
1184131836 22:42521172-42521194 CCGGGCTCGGAAAGGTCAGCAGG - Intergenic
1184259560 22:43306851-43306873 CCAGGCACGGAGAAGTGGACTGG + Intronic
1184276447 22:43411863-43411885 CCGGGCGCGGAGAGGCGGGGAGG + Intronic
1184680074 22:46067194-46067216 CTGGGCAAGGAAATGTGGGCAGG - Intronic
1184861907 22:47177108-47177130 CCGGGCAGGGTGAGGTGCACAGG - Intergenic
1185190443 22:49433040-49433062 CCGGGCAGGGAGAGGGCGGATGG - Intronic
1185242645 22:49754941-49754963 CAGGGCACGGACAGGTGGGCGGG + Intergenic
950153590 3:10707057-10707079 CAGGGCAAGGAGGGGTGGCCAGG + Intronic
950316332 3:12004704-12004726 CCGGGCCCGGCGAGGCGGTCGGG - Exonic
950433867 3:12967333-12967355 CCGGGTGCTGAGCGGTGGGCTGG - Intronic
950683994 3:14603236-14603258 GCGGGCGCGGAGAGGACGGCTGG + Intergenic
950890629 3:16400940-16400962 CCAGGCAGGGCGAGGTGGGAGGG - Intronic
950939923 3:16883337-16883359 CCTGGGATGGAGAGGTGGGTGGG + Intronic
950940376 3:16885078-16885100 CCGGGCCCGGGGAGGTGGGCAGG - Intronic
951016903 3:17742153-17742175 GCGGGCAGGGCGAGCTGGGCGGG - Intronic
954176942 3:48852220-48852242 CCTGGCATGTAGAGGTGGTCAGG - Intergenic
954538737 3:51380173-51380195 CCGGGCAGGGAGGGCTGGGGGGG - Exonic
955931386 3:64060706-64060728 CCCTGCATTGAGAGGTGGGCTGG + Intergenic
957574064 3:81986557-81986579 CCTGGCAGGGAGAGGAGGGGAGG - Intergenic
958141718 3:89570914-89570936 CCAGTCACGGGGAGGTGGGGGGG + Intergenic
960942471 3:122943668-122943690 AGGGGCACACAGAGGTGGGCAGG - Intronic
960993837 3:123328536-123328558 CGGGGCAGGGTGGGGTGGGCAGG - Intronic
961570068 3:127791265-127791287 CCTGGGACAGAGAGGTGTGCGGG - Intronic
961722881 3:128907948-128907970 CTGGTCACGGAGAGGTGGGGGGG + Intronic
963028297 3:140941933-140941955 CCGGGGACGGCGAGGAGAGCTGG - Exonic
964801837 3:160565732-160565754 CCGGGCCCGGAGGGGTGCGGCGG + Intergenic
968066652 3:195762797-195762819 CCGGGAGCAGCGAGGTGGGCGGG - Intronic
968084433 3:195868059-195868081 CCGGGCTGGGAGAGGGGGCCGGG + Exonic
968289369 3:197526734-197526756 CGGAGCACGGAGAGCTGGTCGGG - Intronic
968472143 4:787039-787061 CGGGGCAGGGAGGGGTGGGCAGG + Intronic
968473168 4:791192-791214 CGGGGGGCGGAGGGGTGGGCTGG + Intronic
968942320 4:3645227-3645249 TCGGCCAGGGCGAGGTGGGCAGG - Intergenic
968976007 4:3822346-3822368 CCGGGCACTGCCAGGTGGGAGGG - Intergenic
969183836 4:5461197-5461219 CAGGGCAAGGACAGGTGAGCGGG - Intronic
969317813 4:6392653-6392675 CAGAGCTCAGAGAGGTGGGCTGG + Intronic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
976226716 4:82799830-82799852 CCGTGCCCAGAGAGTTGGGCTGG - Intergenic
976398508 4:84582920-84582942 CCGGGCAGGGAGAAGTGTGCGGG + Intergenic
977109224 4:92930898-92930920 CCAGGCACGGAAAGATTGGCAGG + Intronic
980043665 4:127965693-127965715 CCGGGGACGCGGAGCTGGGCGGG + Intronic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
981917629 4:150052018-150052040 CTGAGGACGGAGAGGTAGGCAGG - Intergenic
984858620 4:184217537-184217559 CTGGGCAGGGAGGGGAGGGCTGG - Intronic
985995151 5:3593579-3593601 CGGGGCACAGAGGAGTGGGCTGG + Intergenic
987050843 5:14145024-14145046 CCGGGCCTGGAGAGGCGGGCGGG + Intronic
987508033 5:18798389-18798411 CCGGGCTCTTAGAGCTGGGCTGG - Intergenic
990610564 5:57452796-57452818 CCAGGCACAGAGAGGTGAGAAGG - Intergenic
991293069 5:65051362-65051384 GAGGGCACAGAGGGGTGGGCTGG - Intergenic
997472809 5:134126111-134126133 CCAGGCAGGCAGAGGTGGGTGGG + Intronic
997528965 5:134570613-134570635 CGGGGGATGGAGAGGTGGGCAGG - Intronic
997998030 5:138602355-138602377 CCATGCACGGAGAGATGGGAGGG - Intergenic
998129098 5:139642333-139642355 AGGGGCTCGGAGAGGTGGGGGGG + Intergenic
999128825 5:149267018-149267040 CCGGGCAGGGAAGGGTGTGCAGG - Intergenic
999147865 5:149407669-149407691 CCGGGCACTGAGAGCAGAGCTGG - Intergenic
1003160358 6:3629111-3629133 CCTGTCTCGGAGAGGTGGGTAGG + Intergenic
1003369103 6:5507704-5507726 GAGGCCACTGAGAGGTGGGCTGG - Intronic
1006151618 6:31993003-31993025 CCGGGCAGGAAGGGCTGGGCAGG + Intronic
1006157919 6:32025741-32025763 CCGGGCAGGAAGGGCTGGGCAGG + Intronic
1006460413 6:34154719-34154741 GCGGGCACAGAGAGCCGGGCCGG - Intronic
1006797446 6:36740926-36740948 CCAGGCACGGAGAGGTCAGTGGG + Exonic
1006841082 6:37028182-37028204 CAGGGTGGGGAGAGGTGGGCAGG - Exonic
1013227971 6:108134194-108134216 CGGGGCAGGGAGAGGGGCGCGGG - Intronic
1015143446 6:129959703-129959725 CCAGGCACTGAGAGGTGAGGGGG - Intergenic
1017106784 6:150895310-150895332 CACGGAAGGGAGAGGTGGGCAGG + Intronic
1017696405 6:157021025-157021047 CCGGGCAGGGACGGGTGGGCGGG - Intronic
1018465244 6:164038120-164038142 CAGGCCTGGGAGAGGTGGGCAGG + Intergenic
1018922315 6:168183801-168183823 CTGGGCGTGGAGAGATGGGCTGG + Intergenic
1019373672 7:677047-677069 CCGGCCTCCGGGAGGTGGGCAGG - Intronic
1019548103 7:1588137-1588159 CAGGGCTCGGATAGGAGGGCAGG - Intergenic
1020076797 7:5263665-5263687 CAGGCCAGAGAGAGGTGGGCTGG + Intergenic
1024006169 7:45226075-45226097 CATGGCATGGACAGGTGGGCTGG - Intergenic
1025202298 7:56969929-56969951 CAGGCCAGAGAGAGGTGGGCCGG - Intergenic
1025258036 7:57398791-57398813 CCAGGCCTGGAGAGGTGGGGCGG - Intergenic
1025669649 7:63606998-63607020 CAGGCCAGAGAGAGGTGGGCCGG + Intergenic
1025976811 7:66376854-66376876 CTGGGCCCGGAGAGGAGGCCGGG + Intronic
1026045666 7:66904057-66904079 CTGGGCCCGGAGAGGAGGCCGGG - Intergenic
1033707251 7:143901929-143901951 CGGGGCGGGGAGCGGTGGGCGGG - Intronic
1034271882 7:149807027-149807049 CCGGGGATCTAGAGGTGGGCAGG + Intergenic
1034475561 7:151279628-151279650 CAGGGAAGGGAGAGGTGGGGTGG + Intergenic
1034483621 7:151342004-151342026 CGGGGCCGGGAGCGGTGGGCCGG + Intronic
1034488113 7:151378972-151378994 CCAGGCATGGAGACTTGGGCCGG + Intronic
1035003900 7:155640977-155640999 CAGGGCTGGGAGAGGTGGGGAGG - Intronic
1035004301 7:155644082-155644104 CCGGGCGCGGAGAAGGGGACGGG + Intronic
1035458282 7:159023604-159023626 GCGGGCGTGGTGAGGTGGGCCGG - Intergenic
1035458301 7:159023669-159023691 GCGGGCGTGGTGAGGTGGGCCGG - Intergenic
1035747600 8:1973662-1973684 CGGGGCGCGGGGAGGGGGGCGGG - Intergenic
1037833252 8:22201309-22201331 CCGGCCAGAGGGAGGTGGGCCGG - Intronic
1037880148 8:22569284-22569306 CCGGAGACGGAGGGGTGGGTGGG + Intronic
1038267146 8:26046148-26046170 TCGGGAACGGAGAGGTGGGGAGG - Intergenic
1038311645 8:26449782-26449804 CCGGGCGCGGAGGTCTGGGCGGG + Intronic
1039608414 8:38901164-38901186 CCGGGGAGGGAGAGGGGTGCCGG - Intergenic
1039897703 8:41727950-41727972 CCGGGCAGGATGAGGTGGTCCGG - Exonic
1039906056 8:41787153-41787175 CCTGGCCCAGAGGGGTGGGCTGG + Intronic
1040875784 8:52150572-52150594 GCGGGCAGGGAGAGGGAGGCAGG + Intronic
1041511539 8:58659451-58659473 CCGGGCACGGAGGCAGGGGCCGG - Exonic
1042404653 8:68390210-68390232 CAGGGCACAGAATGGTGGGCTGG - Intronic
1043463750 8:80486135-80486157 CCGGGCTGGGGGAGGGGGGCTGG - Intronic
1045277467 8:100721289-100721311 GCGGGCCCGGGGAGGGGGGCGGG - Intronic
1045547461 8:103141114-103141136 CCGGGCACTGAGAGAGGAGCCGG + Intronic
1048276247 8:133068209-133068231 CAGGGCATGGAGTGCTGGGCAGG - Intronic
1049388541 8:142356365-142356387 CCTGGAATGGGGAGGTGGGCAGG + Intronic
1049429328 8:142551885-142551907 CCTGGCAAGGAGAGGTGAGGTGG + Intergenic
1052763627 9:32618211-32618233 CCCGGCACGGAGAGAAGGCCAGG + Intergenic
1053163711 9:35829996-35830018 TCCGGCAGGGAGGGGTGGGCTGG + Intronic
1053801765 9:41768432-41768454 CCGGGCATGGTGGGGTGGGTGGG - Intergenic
1054190199 9:61980586-61980608 CCGGGCATGGTGGGGTGGGTGGG - Intergenic
1054648321 9:67608005-67608027 CCGGGCATGGTGTGGTGGGTGGG + Intergenic
1056752646 9:89363393-89363415 CCGGGCAAAGAAAGGAGGGCTGG - Intronic
1056873194 9:90304210-90304232 CCTGGCACAGAGTGGTGGGGTGG - Intergenic
1057227434 9:93299824-93299846 GCGGGCAGGGTGGGGTGGGCGGG - Intronic
1057423075 9:94927662-94927684 CAGGGGAGGGAGAGATGGGCAGG - Intronic
1057906536 9:98987753-98987775 CTGGGGATGGAGTGGTGGGCAGG + Intronic
1059419160 9:114180480-114180502 GCGGGCAGGGAGAGTTGGGGTGG - Intronic
1060212227 9:121717679-121717701 CCGGGCACTGAGAGGAGGCCCGG + Intronic
1060806852 9:126583187-126583209 CCGAGCAGGGTGAGGTGGGGAGG - Intergenic
1061580283 9:131531771-131531793 CCAGGCACGGAGCGGGGGGGCGG - Intergenic
1061618195 9:131793906-131793928 GAGGGCAGGGAGAGGTGGGGTGG + Intergenic
1061825046 9:133252667-133252689 CCGGGCCTGGAGGGGTGGGGTGG - Intronic
1061868798 9:133509212-133509234 CTGGCCATGGAGAGGTGGCCTGG + Intergenic
1062002843 9:134225461-134225483 CTGGGCAGTGGGAGGTGGGCAGG + Intergenic
1062179675 9:135184602-135184624 CCGTATACGGGGAGGTGGGCAGG - Intergenic
1062421333 9:136484000-136484022 CCGGGCAGGGAGGGGCGGCCCGG + Exonic
1062524896 9:136974214-136974236 ACAGGCACAGAGAGGAGGGCTGG + Intergenic
1062689896 9:137836190-137836212 CAGGGGACAGAGAGCTGGGCCGG - Intronic
1203745374 Un_GL000218v1:38228-38250 CTGGGCACTGAGAGCTGGGCTGG + Intergenic
1203564734 Un_KI270744v1:81256-81278 CTGGGCACTGAGAGCTGGGCTGG - Intergenic
1186026576 X:5320069-5320091 CTGGGCACGGGGAGATGGCCTGG - Intergenic
1188069353 X:25700151-25700173 ACGGGCAGGGAGAGTTGTGCAGG + Intergenic
1189310682 X:40015111-40015133 CCGTGCCGGGAGAGGGGGGCGGG + Intergenic
1190267286 X:48835155-48835177 CCGGGCACGGAGAGGTGGGCAGG + Intronic
1192031204 X:67514307-67514329 CCTGTCAGGGAGAGGGGGGCTGG + Intergenic
1198398936 X:136251280-136251302 GCGGGCACGGATGGGTGAGCGGG - Exonic
1199264849 X:145818099-145818121 CCTCGCAAGGAGAGGTGGCCGGG - Intronic
1199684417 X:150253930-150253952 CTGGGCACCAAGATGTGGGCTGG - Intergenic
1200102630 X:153695526-153695548 CAGAGCCTGGAGAGGTGGGCAGG - Exonic
1201158693 Y:11153239-11153261 CTGGGCACTGAGAGCTGGGCTGG + Intergenic