ID: 1190268663

View in Genome Browser
Species Human (GRCh38)
Location X:48845429-48845451
Sequence CCTGGGGACCCTGTTTCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190268650_1190268663 27 Left 1190268650 X:48845379-48845401 CCACACCACTTCACTCCAGCCGG No data
Right 1190268663 X:48845429-48845451 CCTGGGGACCCTGTTTCCCTCGG No data
1190268654_1190268663 22 Left 1190268654 X:48845384-48845406 CCACTTCACTCCAGCCGGGGTGA 0: 6
1: 1098
2: 89371
3: 180699
4: 209381
Right 1190268663 X:48845429-48845451 CCTGGGGACCCTGTTTCCCTCGG No data
1190268656_1190268663 12 Left 1190268656 X:48845394-48845416 CCAGCCGGGGTGACAGAGCAGGA No data
Right 1190268663 X:48845429-48845451 CCTGGGGACCCTGTTTCCCTCGG No data
1190268657_1190268663 8 Left 1190268657 X:48845398-48845420 CCGGGGTGACAGAGCAGGAGAAC No data
Right 1190268663 X:48845429-48845451 CCTGGGGACCCTGTTTCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190268663 Original CRISPR CCTGGGGACCCTGTTTCCCT CGG Intergenic
No off target data available for this crispr