ID: 1190275455

View in Genome Browser
Species Human (GRCh38)
Location X:48896535-48896557
Sequence ACAGAGGAGCTCCAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190275455 Original CRISPR ACAGAGGAGCTCCAGTTGGG TGG Intronic
900205609 1:1430863-1430885 ACAGAGGAACACCTGTGGGGGGG + Intergenic
900856480 1:5189296-5189318 AGAGAGGAGCTGCTGTGGGGTGG - Intergenic
902651616 1:17841233-17841255 CCAGAGGAGCTGCAGGTGAGGGG - Intergenic
903626423 1:24733874-24733896 ACAGAGGAGGCCAAGGTGGGAGG - Intergenic
911783980 1:101921451-101921473 AGAGAGGAACTTCAGTCGGGAGG + Intronic
912005548 1:104895507-104895529 ACAGAGGAGCTCCAGGAAGATGG - Intergenic
915400169 1:155616264-155616286 ACAGTACAGCTCCAGTTGTGGGG + Intergenic
915417375 1:155752459-155752481 ACAGTACAGCTCCAGTTGTGGGG + Exonic
920012791 1:202881712-202881734 AAAGAGGGGCACCAGCTGGGTGG + Intronic
923024858 1:230196189-230196211 ACAGAAGAGACCCAGTAGGGAGG - Intronic
1064277073 10:13915920-13915942 AACAAAGAGCTCCAGTTGGGGGG + Intronic
1064571280 10:16695957-16695979 ACAGAGGATATCCAGATGAGGGG - Intronic
1066704603 10:38164489-38164511 GCTGAAGAACTCCAGTTGGGAGG - Intergenic
1067211033 10:44260672-44260694 ACAGAGGAGACCCAGTGGGGAGG + Intergenic
1069820684 10:71225787-71225809 AGAGAGAAGCTCAAGTTGGAAGG + Intronic
1069915880 10:71786457-71786479 GCAGAGGAGCACCACATGGGAGG - Intronic
1070159180 10:73855364-73855386 ACAGACCAGCTCCATTAGGGAGG + Intronic
1070322648 10:75365951-75365973 CCAGAGGAGCCCCAGTGAGGAGG + Intergenic
1072063225 10:91838211-91838233 AAAGAGGAGATGAAGTTGGGGGG + Intronic
1072930587 10:99659136-99659158 ACAGAGTAGCTCCGGTAGGTGGG - Intergenic
1073257225 10:102160636-102160658 AGAGAGCAGCTCCAGTGAGGAGG + Exonic
1075564609 10:123494404-123494426 ACAGAGGAGCCTCGGTTGGGTGG + Intergenic
1075967797 10:126627829-126627851 ACACATGAGGTCGAGTTGGGAGG - Intronic
1076092500 10:127699915-127699937 ACAAAGCAGGTCCAGCTGGGTGG - Intergenic
1076773007 10:132677286-132677308 ACAGAGGAGCCCCAGTGGGGAGG - Intronic
1076906941 10:133367177-133367199 ACAGGGGAGCACCAGATGTGGGG - Intronic
1077347907 11:2072837-2072859 CCAGAGGAGCTCCAGTGAGCGGG - Intergenic
1080968856 11:37246222-37246244 ACAAAGCAGCTCCAACTGGGTGG - Intergenic
1081595242 11:44454328-44454350 ACCCAGGAGCTCCAGTAGGGCGG + Intergenic
1081852177 11:46281442-46281464 CCAGAGAAGCCCCAGCTGGGAGG + Intronic
1084076485 11:66782099-66782121 ACAGAGGAGATAGAGTTTGGAGG - Intronic
1084371076 11:68743856-68743878 ACAAAGGAGATGCAGGTGGGGGG + Intronic
1084751391 11:71206284-71206306 ACAGAGGAGATCCGGGTGTGCGG - Intronic
1085626373 11:78076844-78076866 ACAAAGGAGATACAGTTGGGAGG - Intronic
1089184742 11:116607186-116607208 GCAGAGGAGCTGCAGTTGCCTGG + Intergenic
1090736293 11:129614523-129614545 AGGGAGGATCTCCACTTGGGTGG + Intergenic
1090740414 11:129654562-129654584 AGTGAAGAGCTCCAGTAGGGTGG + Intergenic
1092172987 12:6384849-6384871 AAAGAGGAGGCCCAGTGGGGAGG - Intronic
1093816395 12:23553735-23553757 ACACAGGATGTCCAGTTGGTGGG + Intronic
1094027013 12:25969729-25969751 ACAGGGGTTCTCCAGTGGGGTGG + Intronic
1095939480 12:47716718-47716740 ACTGTGGATATCCAGTTGGGAGG - Intronic
1095948630 12:47768344-47768366 ACAGAGGAGGACCAGTTAGGAGG + Intronic
1100858571 12:98780189-98780211 ACGGAGGGGGTCCAGGTGGGAGG + Intronic
1102423858 12:112825083-112825105 CCAGAGGTCCTCCAGGTGGGGGG + Intronic
1104469055 12:129014220-129014242 AGAGAGGAGCTCCAGTAAGCTGG - Intergenic
1104907994 12:132225444-132225466 ACAGTGGAGTTTCAGTTGTGTGG - Intronic
1106437970 13:29740463-29740485 ACAAAGTACCTCCAATTGGGTGG - Intergenic
1113138243 13:107117554-107117576 ACAGAAGAGCGGCAGCTGGGAGG + Intergenic
1113457369 13:110458198-110458220 ACAGAGGATGCCCAGTGGGGAGG - Intronic
1118177334 14:63454772-63454794 CCAGGGAAGCTCCAGTTTGGGGG - Intronic
1119564870 14:75619893-75619915 ACAGTGTAGCACCAGCTGGGAGG + Intronic
1121386082 14:93526883-93526905 TAAGAGGAGCTCCACATGGGGGG + Intronic
1121605502 14:95237240-95237262 ACAGAGGCCCTGCAGATGGGCGG + Intronic
1122461983 14:101903535-101903557 ACAGACGAGGGCGAGTTGGGGGG - Intronic
1122820709 14:104343405-104343427 ACAGAGGGCCTCCAGCTGGAGGG - Intergenic
1124069590 15:26378918-26378940 ACAGAGGAGACCCAGAAGGGAGG - Intergenic
1124214485 15:27795377-27795399 ACAGAGAAGCTCTTGGTGGGAGG - Intronic
1126098648 15:45106676-45106698 ACAGTGGAGCTCTAGGTGAGGGG - Intronic
1131158313 15:90088526-90088548 GGCGAGGAGCTCCAGTCGGGGGG + Intronic
1131449467 15:92527459-92527481 ACAGAGGGACTTCAGGTGGGTGG - Intergenic
1132433979 15:101781815-101781837 CCAGAGGTGCCACAGTTGGGGGG + Intergenic
1132748034 16:1445107-1445129 GCAGAGGCGCTCCAGGTGGAGGG - Exonic
1134528564 16:14963941-14963963 ACTCAGGAGATCGAGTTGGGAGG - Intergenic
1134562925 16:15226360-15226382 ACAGCAGAGCTACAGTGGGGTGG + Intergenic
1134923462 16:18137993-18138015 ACAGCAGAGCTACAGTGGGGTGG + Intergenic
1141151292 16:81566137-81566159 ACAGAGGTGCTTCAGATTGGAGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141665961 16:85465231-85465253 AGGCAGGAGCTCCAGGTGGGCGG - Intergenic
1142010544 16:87711755-87711777 ACAGAGGGGCTTCTGTGGGGAGG + Intronic
1142144193 16:88485962-88485984 AGAGAGGAGGTGCAGTTGGTGGG + Exonic
1144754903 17:17673589-17673611 ACAGAAGAGATGCAGATGGGGGG - Intergenic
1144791305 17:17860908-17860930 ACAGAGCTGGTGCAGTTGGGTGG - Intronic
1148823226 17:50373066-50373088 AGAGTGGAGCTCCAGCAGGGAGG - Intronic
1151292084 17:73157581-73157603 AAAGAGGAGCTGCTGCTGGGGGG - Intergenic
1151669507 17:75564321-75564343 ACAGAGGAGCGGCAGTGGGCTGG - Intronic
1152882518 17:82827215-82827237 ACTGAGCAGCTTCAGTAGGGTGG + Intronic
1154215342 18:12411763-12411785 ACAGTGGAACACCAGTGGGGAGG - Intronic
1157482749 18:48066035-48066057 ACAGAAGACCTCCAAATGGGTGG - Intronic
1160366700 18:78332254-78332276 ACAGAGCGGCTCCTCTTGGGGGG + Intergenic
1161776058 19:6262779-6262801 ACAGGGGAGCCCCAGGTGGCTGG + Intronic
1162057721 19:8074653-8074675 GCAGAGGCCCTCCATTTGGGGGG - Intronic
1162299133 19:9834513-9834535 ACGGAGGAGGTGCAGGTGGGAGG - Intergenic
1162803420 19:13123518-13123540 AGAGAATAGCTGCAGTTGGGAGG + Intronic
1164394623 19:27851854-27851876 TCACAGGAGCTGCAGTGGGGAGG + Intergenic
1164726925 19:30471978-30472000 ACCGAGGAGCTCCATTAGAGGGG + Intronic
1166719128 19:44987512-44987534 GCAGAGGAGCACCAGGCGGGAGG - Intronic
1168360200 19:55733222-55733244 AGAGAGGAGCTCCAGTAAGCTGG + Exonic
929797578 2:45072111-45072133 CCAGATGAGCTCCAGCTTGGTGG - Intergenic
931622986 2:64229753-64229775 AGAGGGGAGCGCCAGTGGGGAGG + Intergenic
932454039 2:71834841-71834863 ACAAAGGATCTCAGGTTGGGGGG - Intergenic
933390030 2:81656560-81656582 ACCGAGGATCTCAAGTGGGGGGG + Intergenic
935019719 2:99218112-99218134 ACAGAGGAGATCCACCAGGGAGG + Intronic
940819631 2:158337854-158337876 ACAGAGGAGCTGCAGTTCACAGG + Intronic
942252105 2:174055835-174055857 ACTGAGTAGCTCCAGTTTTGCGG + Intergenic
943935004 2:193904358-193904380 GCAGGGAAGCTCCAGCTGGGTGG + Intergenic
948769151 2:240239292-240239314 TGAAAGGAGCTCCAGGTGGGTGG + Intergenic
1169076469 20:2762916-2762938 ACAGAGGAGGTACAGATGAGGGG + Intergenic
1170049743 20:12129212-12129234 ACAAAGCAGCTCCAACTGGGTGG - Intergenic
1172899730 20:38325709-38325731 ACAGAGAAGCTCTGGTTGGGGGG + Intronic
1173096151 20:40030491-40030513 ACAGAAGAGCTCCAGGTGTGAGG + Intergenic
1173337929 20:42128082-42128104 ACATAGCAGCTCCATTTGAGGGG - Intronic
1174647034 20:52095277-52095299 ACAGATGAGCTCGAGTGGTGTGG + Intronic
1175910041 20:62400746-62400768 GCAGAGGAGCTGCAGCAGGGAGG + Intronic
1176077527 20:63255040-63255062 GCAGAGGAGCTCCCTGTGGGAGG - Intronic
1177550681 21:22618168-22618190 ACAGAGTAGCACAAATTGGGTGG + Intergenic
1178696379 21:34796427-34796449 ACAGAAGAGCTACAGCTGGATGG - Intronic
1178708889 21:34896830-34896852 CCAAAGGAGCTTCAGTTGAGTGG + Intronic
1179954743 21:44732325-44732347 ACAGAGGAGATGCAGGTGAGGGG + Intergenic
1183198386 22:36368990-36369012 ACAGAGGGGCTGCAGAGGGGTGG - Intronic
1183991240 22:41598391-41598413 ACAGTGGGGCTCCCATTGGGAGG + Exonic
1185128728 22:49025712-49025734 ACAGTGGAGCTCATCTTGGGGGG + Intergenic
950972778 3:17205616-17205638 ACAGAGGACCAGTAGTTGGGGGG - Intronic
953243736 3:41172129-41172151 ACTGTGGAGCTCCATTTGGCTGG - Intergenic
954634518 3:52064415-52064437 ACGGAGGAGCTGTAGCTGGGTGG - Intergenic
955110992 3:55949727-55949749 ACAGAGCAGTTCAAGTTGGCCGG - Intronic
956702499 3:71970846-71970868 ACAAAGGACCACAAGTTGGGTGG - Intergenic
960409035 3:117299218-117299240 ACAGAAGAGGTCAAGGTGGGTGG - Intergenic
961466492 3:127084966-127084988 ACAAAGGAGCTCCAGGCTGGGGG - Intergenic
964411978 3:156407322-156407344 ACAGAGGAGATGCATTTGAGCGG - Intronic
964534446 3:157704139-157704161 ACAGAGAAGCAGCAGTTTGGTGG - Intergenic
965682123 3:171262298-171262320 ACAGAGGAGGTGGAGTGGGGTGG - Intronic
966594128 3:181711406-181711428 CCAGAGGGGCTGGAGTTGGGGGG + Intergenic
967585630 3:191210940-191210962 ATAGATGAGCTTCAGTTGGCTGG + Intronic
968128486 3:196177600-196177622 ACAGAGGTGCTCAAGGTGAGAGG + Intergenic
968460336 4:721604-721626 ACAGAGAAGCTCCTGGTGAGCGG + Intronic
968600029 4:1504350-1504372 ACAGGGGAGCTCCAGAAGGTGGG + Intergenic
968801470 4:2745963-2745985 CCAGAGGATCTCCAGTGAGGGGG + Intronic
969314339 4:6372463-6372485 GCAGAGTAGCTTCCGTTGGGTGG - Intronic
970808893 4:20067809-20067831 TCACAAGAGCTCAAGTTGGGAGG + Intergenic
971404797 4:26312488-26312510 TCAGGGGAACTCCAGGTGGGGGG - Intronic
972688271 4:41371784-41371806 AGAGTGGAGCTGCTGTTGGGAGG - Intronic
972828178 4:42785932-42785954 ACAGAGTAGCTGCAATTGTGAGG - Intergenic
973570576 4:52234806-52234828 AAAGAGGAATTCTAGTTGGGTGG - Intergenic
978622561 4:110648262-110648284 ACAGAGGAGCTTGAGTTGGGAGG + Intergenic
984132647 4:175897263-175897285 TCAGAGGAGCTGCATTTGAGAGG + Intronic
984554935 4:181202307-181202329 ACAGGGGAGTTACAGCTGGGTGG + Intergenic
987589261 5:19902445-19902467 ACAGAGGAGCTCAAGCTGAGGGG + Intronic
990269332 5:54118663-54118685 ATAGAAGAGCTGGAGTTGGGAGG + Intronic
990695800 5:58415777-58415799 ACAGAGGTGCTCCACTAAGGAGG - Intergenic
993092850 5:83448467-83448489 ACATAGTAACTCCATTTGGGAGG - Intergenic
1002109413 5:176898209-176898231 GCAGAGGTGATCAAGTTGGGTGG - Intronic
1002675349 5:180908043-180908065 ACAAAGCAGCTCCAACTGGGTGG - Intronic
1003551693 6:7107258-7107280 TCAGAGGCGCTGGAGTTGGGGGG - Intergenic
1006098270 6:31669740-31669762 ATAGAGGAGCTCAGGTGGGGAGG + Intronic
1006329735 6:33381837-33381859 ACACAGGACCACCAGTAGGGTGG + Intergenic
1006414222 6:33893849-33893871 ACTGATGAACTCCAGTTGGGGGG + Intergenic
1008046931 6:46860614-46860636 ACAGAGAAGCTGCAATGGGGAGG + Intronic
1008623312 6:53293260-53293282 TCAGAGAAGCAGCAGTTGGGAGG + Intronic
1009316762 6:62229534-62229556 CCAGCCGAGCTCCAGTGGGGAGG - Intronic
1015297509 6:131614600-131614622 ACAGGTGAGCTCCAGTTGAGAGG + Intronic
1018458808 6:163977846-163977868 AGAGAGGAGCTCCAAATGGCAGG - Intergenic
1018736976 6:166694278-166694300 ACAGAGGAGCGGGAGTTGGACGG + Intronic
1020355982 7:7276305-7276327 ACAGAGGAGCTCAAATTTGAAGG - Intergenic
1020828891 7:13067836-13067858 ACAGAGAAGCTACATTTTGGAGG + Intergenic
1022034106 7:26517724-26517746 ACAGATAAGCTCCAGTTGCAGGG - Intergenic
1022038452 7:26556512-26556534 CCAGAGGAGCTCCAGGTTTGAGG + Intergenic
1023631262 7:42166548-42166570 AAAGCATAGCTCCAGTTGGGGGG + Intronic
1024000087 7:45184132-45184154 ACAGAGGAGCCCCTGTAGGAAGG - Exonic
1025975479 7:66366149-66366171 AAAGAGGAGTTCAAGGTGGGAGG + Intronic
1026359562 7:69591230-69591252 ACAGAGTAGCTCCTTTTGGCTGG + Intergenic
1030373021 7:108721666-108721688 ACAGAGGACATCCAGCTGGTGGG - Intergenic
1032371881 7:131363888-131363910 AGATAGGATCTCCAGTTGTGAGG - Intronic
1033297948 7:140158279-140158301 ACAGAGGGGGACCAGTTAGGAGG + Intronic
1034981570 7:155481736-155481758 ACAAAGGGGATCCACTTGGGAGG - Intronic
1035049105 7:155988286-155988308 AGAGAGGAGCTTCAGGTGTGTGG + Intergenic
1035587663 8:788096-788118 ACACAGGATCTCCTGGTGGGGGG - Intergenic
1035753938 8:2017270-2017292 AGAGAGAAGCTCCAGTTGTTTGG - Intergenic
1035983611 8:4401525-4401547 ACAGGGGAGCTACTGCTGGGAGG - Intronic
1039181208 8:34868702-34868724 ACCTAGGAGCTCCTGCTGGGTGG - Intergenic
1043501769 8:80865402-80865424 ACAGAGAAGTAACAGTTGGGTGG + Intronic
1044079656 8:87867798-87867820 ACACAGGAGCACCAGGTGGGAGG + Intergenic
1044948871 8:97416514-97416536 GCAGAGGAGATCCAGTTTAGGGG + Intergenic
1046011773 8:108557232-108557254 TCAGAGAAGCTTCAGTAGGGTGG + Intergenic
1046389670 8:113553754-113553776 ACAGAGGAGATTGAGGTGGGAGG + Intergenic
1049447985 8:142640334-142640356 AGGGAGGAGCCCCAGCTGGGAGG - Intergenic
1049693241 8:143971882-143971904 CCAGAGGAGCTGCGCTTGGGAGG + Intronic
1050225896 9:3455032-3455054 AAGGAAGAGTTCCAGTTGGGTGG - Intronic
1050306841 9:4313445-4313467 ACTGAGGACCTCAAGTTGGGTGG - Intronic
1051434688 9:17018402-17018424 CCAGGAGAGGTCCAGTTGGGAGG - Intergenic
1055779231 9:79801197-79801219 ACTGAGGAGGTAAAGTTGGGAGG - Intergenic
1061372081 9:130202956-130202978 TCAGAGAAAGTCCAGTTGGGAGG + Intronic
1062401735 9:136375806-136375828 ACACAGGAACACCAGGTGGGGGG + Intronic
1189286638 X:39856341-39856363 ACAGAGGATCTCAATTTGGCCGG - Intergenic
1190275455 X:48896535-48896557 ACAGAGGAGCTCCAGTTGGGTGG + Intronic
1192891690 X:75398187-75398209 AAAAAGGAGCTCCTGGTGGGAGG + Intronic
1196544540 X:116946797-116946819 GCAGGGAAGCTCCAGCTGGGTGG - Intergenic
1200089613 X:153628174-153628196 ACAGAATTGCTCCACTTGGGTGG - Intergenic
1200151890 X:153955249-153955271 ACAGACGAACTGCACTTGGGTGG + Exonic