ID: 1190275506

View in Genome Browser
Species Human (GRCh38)
Location X:48896804-48896826
Sequence ACCGATGACACCCATAGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190275503_1190275506 -7 Left 1190275503 X:48896788-48896810 CCTGGAAGACTCCGCCACCGATG 0: 1
1: 1
2: 0
3: 2
4: 48
Right 1190275506 X:48896804-48896826 ACCGATGACACCCATAGTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1190275501_1190275506 3 Left 1190275501 X:48896778-48896800 CCCTTGATGGCCTGGAAGACTCC 0: 1
1: 0
2: 1
3: 14
4: 137
Right 1190275506 X:48896804-48896826 ACCGATGACACCCATAGTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1190275502_1190275506 2 Left 1190275502 X:48896779-48896801 CCTTGATGGCCTGGAAGACTCCG 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1190275506 X:48896804-48896826 ACCGATGACACCCATAGTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190275506 Original CRISPR ACCGATGACACCCATAGTGA AGG Exonic
903126313 1:21250669-21250691 ACTGATGACACCCTCTGTGAGGG + Intronic
905207683 1:36352170-36352192 AACGAGGACACCCCTGGTGAGGG - Intronic
908581405 1:65520969-65520991 AGCCATGACACCCATGCTGAAGG - Intronic
908782681 1:67705909-67705931 AACGATCACACCCGAAGTGAGGG + Intronic
911404887 1:97424228-97424250 ACCCATTACACCTATAGTAATGG + Intronic
1062943348 10:1440201-1440223 ACTCAGGAGACCCATAGTGAAGG - Intronic
1069288475 10:66746129-66746151 ACCGAAGACAGCCAGAGAGATGG - Intronic
1071194220 10:83138743-83138765 AACGATGTTTCCCATAGTGACGG + Intergenic
1084893271 11:72247562-72247584 ACCTATGACATGCAGAGTGATGG - Intergenic
1093000075 12:13986424-13986446 TCCAATGACACCCAGTGTGAGGG + Intergenic
1095857614 12:46877947-46877969 AGCCATCACACACATAGTGAAGG - Intergenic
1106176849 13:27339036-27339058 AGCCAGGACACCCACAGTGAAGG - Intergenic
1108215693 13:48182041-48182063 TGGGAGGACACCCATAGTGAGGG + Intergenic
1108796924 13:54043567-54043589 ACCTAGGACTCCCAAAGTGAGGG - Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1130813031 15:87402348-87402370 ACGGATGATACCCACAGTCAAGG - Intergenic
1133842138 16:9419607-9419629 GCAGATGATCCCCATAGTGAGGG + Intergenic
1147477123 17:40722910-40722932 ACCCAAGACACGCATAGTGTAGG - Intergenic
1153981831 18:10316928-10316950 ACAGAGGACACCCATGGGGACGG + Intergenic
1154969801 18:21395975-21395997 ACCTCGGACACCCAAAGTGATGG + Intronic
1164683280 19:30150136-30150158 ATCGATCACAGCAATAGTGATGG - Intergenic
925977066 2:9149192-9149214 TCAGATGACACCAAGAGTGAGGG + Intergenic
939178052 2:138772766-138772788 ATCACTGACACCCAGAGTGATGG - Intronic
942828461 2:180209772-180209794 ACTGTTGACACCCAATGTGAGGG + Intergenic
1171182713 20:23102632-23102654 ACCGTTGACATCAATACTGAGGG - Intergenic
1172934953 20:38613476-38613498 ACCAATGACACCCAAACTGCTGG - Intronic
1184394005 22:44221953-44221975 ACAGATGGCACCCACAGGGAAGG - Intergenic
953065859 3:39470252-39470274 ACAGACCACACCCATATTGAGGG + Intronic
953722680 3:45369820-45369842 ACCCAGTACACCCATAGTGGTGG + Intergenic
956794322 3:72704295-72704317 ACAGATGCCACCCATAAGGACGG + Intergenic
962389786 3:134961541-134961563 ACTGATGACAACCAGAGTGGAGG - Intronic
977768341 4:100827398-100827420 ACCGGTGACATCCATGGTGAAGG + Intronic
980667180 4:135955218-135955240 AGCTATGACACCCACACTGAAGG - Intergenic
983054427 4:163085110-163085132 ACCGAAGACACCCAGAGTACTGG - Intergenic
985526312 5:404355-404377 ACTGAAGACACCCAGAATGAAGG - Intronic
986410797 5:7476544-7476566 CCTGATGACACCCAAAGGGAAGG - Intronic
998354424 5:141522978-141523000 ACAGATGAAACTCACAGTGATGG + Intronic
1014576388 6:123079645-123079667 ACCAATGACATCCATAGAGCTGG - Intergenic
1029258421 7:99285075-99285097 ACGGATTTCACCCCTAGTGAGGG - Intergenic
1035314077 7:157987400-157987422 ACCGATCACCCCATTAGTGAGGG - Intronic
1038718850 8:30015286-30015308 AGCCATGACACCCTTACTGAAGG + Intergenic
1041101265 8:54398378-54398400 ACCAATGACTCCCATATTGCTGG - Intergenic
1042782419 8:72506463-72506485 AGTGATGACAGCCATAGTGATGG - Intergenic
1061702246 9:132424655-132424677 AGTGGTGACACCCAAAGTGAAGG - Intronic
1190275506 X:48896804-48896826 ACCGATGACACCCATAGTGAAGG + Exonic
1199776543 X:151016566-151016588 AAGGAAGACGCCCATAGTGATGG - Intergenic
1201354157 Y:13080375-13080397 ACCCATGACACACCTACTGAGGG + Intergenic