ID: 1190275767

View in Genome Browser
Species Human (GRCh38)
Location X:48898167-48898189
Sequence CCCGGCAGTCATGGGGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190275755_1190275767 5 Left 1190275755 X:48898139-48898161 CCCCATCCCAGCGCTTTGGTTTC 0: 1
1: 0
2: 4
3: 16
4: 157
Right 1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1190275754_1190275767 6 Left 1190275754 X:48898138-48898160 CCCCCATCCCAGCGCTTTGGTTT 0: 1
1: 0
2: 3
3: 15
4: 193
Right 1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1190275759_1190275767 -2 Left 1190275759 X:48898146-48898168 CCAGCGCTTTGGTTTCTCCCACC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1190275756_1190275767 4 Left 1190275756 X:48898140-48898162 CCCATCCCAGCGCTTTGGTTTCT 0: 1
1: 0
2: 1
3: 10
4: 214
Right 1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1190275752_1190275767 14 Left 1190275752 X:48898130-48898152 CCTCTGCTCCCCCATCCCAGCGC 0: 1
1: 0
2: 4
3: 64
4: 687
Right 1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1190275751_1190275767 15 Left 1190275751 X:48898129-48898151 CCCTCTGCTCCCCCATCCCAGCG 0: 1
1: 0
2: 2
3: 42
4: 509
Right 1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1190275757_1190275767 3 Left 1190275757 X:48898141-48898163 CCATCCCAGCGCTTTGGTTTCTC 0: 1
1: 0
2: 0
3: 10
4: 204
Right 1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1190275758_1190275767 -1 Left 1190275758 X:48898145-48898167 CCCAGCGCTTTGGTTTCTCCCAC 0: 1
1: 0
2: 0
3: 3
4: 147
Right 1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190275767 Original CRISPR CCCGGCAGTCATGGGGACGC TGG Intronic
900120448 1:1046568-1046590 CACGGTGGTCCTGGGGACGCTGG - Exonic
900344927 1:2205963-2205985 CTCGGCAGGGATGGGGACCCAGG + Intronic
902375875 1:16029753-16029775 CCCGGCAGGCATGGGGATGGTGG - Exonic
902380822 1:16051500-16051522 CCCGGCAGGCATGGGGATGGTGG - Exonic
902477011 1:16693631-16693653 CCCGGCAGTCAGGGCGCCTCAGG + Intergenic
903724090 1:25428242-25428264 CACTGCAGTCATGGGGATGAGGG + Intronic
907339738 1:53726443-53726465 CCAGGCAGGCATGGGGACGTGGG + Intronic
907651172 1:56296169-56296191 CCCTGCAGAGATGGGGAAGCAGG + Intergenic
913059671 1:115193576-115193598 CCCTGCAGTCCTGGGGCTGCTGG + Intergenic
913689621 1:121266936-121266958 CCAGGCAGCCATGGGGAAGGTGG - Intronic
914147977 1:145013336-145013358 CCAGGCAGCCATGGGGAAGGTGG + Intronic
915805319 1:158842524-158842546 CTCAGCAGTCATGGGGATGTTGG + Intronic
920476944 1:206285410-206285432 CCAGGCAGCCATGGGGAAGGTGG - Intronic
920944333 1:210514384-210514406 ACCAGCAGTCATGGGAAAGCAGG + Intronic
922480805 1:225939286-225939308 CCAGACAGTCCTGGGGACGGGGG + Intronic
1067058863 10:43067601-43067623 CCCTGCACTCATGGGGACCTAGG - Intergenic
1067703616 10:48590758-48590780 CCTGGCCGTCCTGGGGACTCTGG + Intronic
1071526562 10:86362977-86362999 CCCCGCAACCATGGGGACTCTGG - Intronic
1074710455 10:116172863-116172885 TCTGGCAGTCATGGGGAGGTAGG + Intronic
1074860140 10:117503687-117503709 CCCTGCAGGCATGGGGTCCCGGG - Intergenic
1077442104 11:2573671-2573693 CCCGGGAGCCTTGGGGAAGCCGG + Intronic
1081608172 11:44540627-44540649 CCCTGCTGTCATGGAGAAGCAGG - Intergenic
1091807314 12:3365902-3365924 GCCGGCGGGCAGGGGGACGCTGG - Intergenic
1097224488 12:57469338-57469360 CCCAGCAGTCACTGGGACACAGG + Intronic
1097637510 12:62140749-62140771 CCTGGCAGCCCTGGGGAAGCTGG - Intronic
1108701450 13:52947767-52947789 CCCGGCAGCGATGGGGCTGCAGG + Intergenic
1108773445 13:53733798-53733820 CCTGGGAGTCATGGAGAAGCAGG + Intergenic
1113423287 13:110186480-110186502 CCAGGCAGTCGTGGTGACACCGG - Exonic
1114280993 14:21192385-21192407 CCCTGCACTCTTGGGGACCCGGG + Intergenic
1117736975 14:58777545-58777567 CACGGCAGCCATGGGAACCCTGG - Intergenic
1118836561 14:69482549-69482571 CACAGCAGTCATGGGGAGGTGGG - Intergenic
1120953452 14:90062067-90062089 CCCGGCGGTCATGGGCGAGCCGG + Exonic
1122415653 14:101548405-101548427 CCCAGCTGTCATGGGGAGGGTGG - Intergenic
1122606675 14:102951207-102951229 GCCAGCGGTCATGGGGACGTGGG + Intronic
1122972397 14:105157762-105157784 CGCTGCAGACATGGGGAGGCGGG + Exonic
1126292723 15:47099905-47099927 CCCTGCACTCTTGGGGAGGCTGG - Intergenic
1131172030 15:90185290-90185312 CCCGGTGGCCATGGGAACGCGGG - Intronic
1131437934 15:92438001-92438023 CCAGGCAGTCCTGGGGAAACTGG + Intronic
1132425551 15:101713231-101713253 TCCTGCATTCATGGGGACTCGGG + Intronic
1133667110 16:7979405-7979427 CCCAGCAGAGATGGGGACCCTGG + Intergenic
1137351345 16:47716480-47716502 CCCGGCAATGATGGGGAGGGAGG + Intergenic
1138186993 16:54984446-54984468 CCAGGCTGTCATGAGGACACAGG - Intergenic
1141647170 16:85373760-85373782 CCCGGCAGGCCTGGGGACCCTGG + Intergenic
1141657594 16:85424351-85424373 CCCGGGGCTCATGGGGAGGCTGG + Intergenic
1141689115 16:85586636-85586658 CACGGCAGTCGGGGGGGCGCGGG - Intergenic
1142106533 16:88306612-88306634 CCGGGCAGTCATGGGGCTTCAGG - Intergenic
1144742788 17:17593343-17593365 CCCGGCAGGGCTGGGGACACAGG + Intergenic
1144850735 17:18242677-18242699 CCTGGCAGCCCTGGGGACGGAGG - Intronic
1151601582 17:75109462-75109484 CCCGCCAGCCGTGGGGACCCTGG + Intergenic
1151680780 17:75621589-75621611 CACTGCAGACATGGGGACCCAGG - Intergenic
1151954679 17:77374375-77374397 ACCGGCAGTCAAGAGGACGCAGG - Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1157392274 18:47312721-47312743 CCTGGCAGTCATAGGGGCACTGG + Intergenic
1157986377 18:52442864-52442886 CCAGGCAGTCATGGGGATCAGGG + Intronic
1160104918 18:75964932-75964954 CCTGGCAGTCACGGGGATGCTGG + Intergenic
1160970495 19:1765795-1765817 CACTGCAGCCATGGGGACGCGGG - Intronic
1161306596 19:3572544-3572566 CCCGGTTGCCATGGGGACGGAGG - Intronic
1163233425 19:16018389-16018411 CCCAGCAGGCATGGGGCCACTGG + Intergenic
1167334382 19:48875589-48875611 GCGGGCAGACATGGGGACACAGG - Intronic
1167513934 19:49911861-49911883 CCCAGCAGTCCTGGGGGCTCAGG - Intronic
1167671576 19:50856559-50856581 CCAGGCAGCCATGGGGAGGGTGG - Intronic
1202711028 1_KI270714v1_random:19457-19479 CCCGGCAGTCAGGGCGCCTCAGG + Intergenic
925713821 2:6767210-6767232 CCAGGCGGTGCTGGGGACGCTGG + Intergenic
926122819 2:10254146-10254168 CCAGGCAGTCAGGGGGACAGGGG - Intergenic
927576578 2:24206506-24206528 CCTGGCATTCATGTGGAGGCTGG + Intronic
927830134 2:26342887-26342909 CCCGGCAGGCATGGTCACGTGGG - Intronic
931668131 2:64624733-64624755 CCCCGCTGTCCTGGGGACCCGGG - Intergenic
934846404 2:97663814-97663836 CCCGGCAGCCAGGGGGAGGGCGG - Intronic
934882418 2:97995650-97995672 GCCGGCAGGGATGGGGAAGCGGG - Exonic
936092253 2:109509023-109509045 CCCGGCAGGAATGGGTAAGCTGG - Intergenic
936146104 2:109981523-109981545 CACGGCAGTCAGGGGAAAGCAGG - Intergenic
936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG + Intergenic
937257417 2:120565158-120565180 CCCCGCAGTCCTGGGGCCGGCGG + Intergenic
938072869 2:128317678-128317700 CCCGCCGGACTTGGGGACGCGGG - Intronic
941720199 2:168804354-168804376 TCCGGGAGTCATGGGGAGGGCGG + Intronic
944676750 2:202039399-202039421 CCTGGCAGCCGTGGGGACTCAGG + Intergenic
949018106 2:241724901-241724923 CCTGGGAGACATGGGGAGGCGGG + Intronic
1169193436 20:3671511-3671533 CCAGGCAGTGAGGGGGACACTGG + Intronic
1170029367 20:11929182-11929204 CCCGGCAGTCACAGAGATGCCGG + Intergenic
1171536651 20:25898689-25898711 CCCTGCACTCTTGGGGAGGCTGG + Intergenic
1171839590 20:30193954-30193976 CCCTGCACTCTTGGGGAGGCTGG + Intergenic
1172116995 20:32578951-32578973 GGCTGCAGTCATGGGGACGGGGG + Intronic
1174138754 20:48398439-48398461 CCCTGCACTCTTGGGGACCCAGG - Intergenic
1175913912 20:62416871-62416893 GCCTGCAGGGATGGGGACGCAGG + Exonic
1176237781 20:64062266-64062288 CCAGGCAGTGGTGGGGATGCTGG + Intronic
1176300753 21:5097868-5097890 CCCGTCAGCCCTGGGGATGCTGG + Intergenic
1178881577 21:36454182-36454204 CCCAGCAGGCATGGGGAAGGTGG + Intergenic
1179856281 21:44164085-44164107 CCCGTCAGCCCTGGGGATGCTGG - Intergenic
1180089397 21:45526056-45526078 CCCGGCAGCCACGGGGTCCCAGG + Intronic
1181481109 22:23199650-23199672 CCCTGCACTCATGGGGACAAAGG - Intronic
1182145204 22:27993194-27993216 CCCCGCATTCATGAGGATGCTGG - Intronic
954370860 3:50169006-50169028 CCCAGCAGTGATGGGGACTGGGG - Intronic
954884325 3:53858509-53858531 CCCGGGAGTCTTGGGCACGTGGG + Intronic
964996707 3:162891453-162891475 CCCTGCACTCATGGGGGCCCAGG + Intergenic
967015354 3:185476646-185476668 CCCAGCAATCACGGGGACTCAGG + Intronic
968001492 3:195209717-195209739 CCCGCCAGGCAAGGGGAGGCCGG + Intronic
968739024 4:2318007-2318029 CCTGCCAGTCCTGGGGAAGCAGG - Intronic
969016471 4:4107218-4107240 CGCGGGGGTGATGGGGACGCGGG - Intergenic
969112563 4:4852842-4852864 CCAGGCAGTCCTGAGGACCCAGG - Intergenic
969618965 4:8269595-8269617 CCCGGCAGGCCTTGGGACTCTGG - Intergenic
974235721 4:59179414-59179436 CCCTGCACTCTTGGGGACCCAGG + Intergenic
985512067 5:318637-318659 CACAGCAGTCATGGGGAACCCGG + Intronic
1001325756 5:170722588-170722610 CCAGGCAGACAAGAGGACGCAGG + Intronic
1001638176 5:173227629-173227651 CCAGGCAGCCCTGGGGACCCCGG - Intergenic
1006404759 6:33838488-33838510 TCCGGCAGGCGTGGGGAGGCGGG - Intergenic
1007605356 6:43114029-43114051 CCCAGCAGCCCTGGGGCCGCAGG - Intronic
1025813357 7:64889186-64889208 CCCTGCAGTCATGGGGTCACCGG + Intronic
1029440867 7:100586012-100586034 CCCGGCAGACCTGGAGACCCGGG + Exonic
1032305910 7:130732905-130732927 CCAGGCAGACATGTGGACTCTGG - Exonic
1035171932 7:157021778-157021800 CCCGGCAGCGATGCGGACACGGG - Intergenic
1038251445 8:25908751-25908773 CCCCACAGTGATGGGGAAGCGGG - Intronic
1040595884 8:48837189-48837211 CCAGGCAGCTATGGGGATGCTGG + Intergenic
1045057590 8:98382744-98382766 CCCCTCAGTCATGTGGCCGCTGG - Intergenic
1045244186 8:100428761-100428783 TCCTGCAGTCATGGGGACAGTGG - Intergenic
1049349148 8:142154774-142154796 CCCGGCAGGCATGTGGAGCCTGG + Intergenic
1050305106 9:4298839-4298861 TCCCGCAATCATGGGGACACCGG + Intronic
1057231553 9:93324545-93324567 GCCGGCAGCAATGGGGAGGCTGG - Intronic
1057236535 9:93366072-93366094 GCCGGCAGCCATGGGGAGGCTGG + Intergenic
1057858139 9:98618118-98618140 CCTGACAGCCATGGGGACACAGG - Intronic
1062038445 9:134393057-134393079 CCCGGGAATCATGGGGAAGCGGG + Intronic
1062098917 9:134717873-134717895 CCAGGCAGTCATGGGGGGGCTGG + Intronic
1062308631 9:135923629-135923651 CCCTCCAGTCCTGGGGACGGAGG + Intergenic
1186946908 X:14578843-14578865 CCAGGCAGTCATTTGGAAGCTGG - Intronic
1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG + Intronic
1200122680 X:153798556-153798578 CCAGGCAGACAAGAGGACGCTGG - Intergenic
1201240509 Y:11953621-11953643 CCCGGGAGTCCTGGAGAAGCGGG + Intergenic