ID: 1190277212

View in Genome Browser
Species Human (GRCh38)
Location X:48906536-48906558
Sequence CACGTTACCTAGGTGGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190277205_1190277212 5 Left 1190277205 X:48906508-48906530 CCTCATGGAGGAAGAGAACCAGG 0: 1
1: 0
2: 1
3: 40
4: 330
Right 1190277212 X:48906536-48906558 CACGTTACCTAGGTGGGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 81
1190277201_1190277212 26 Left 1190277201 X:48906487-48906509 CCACATACTGCACCAGGACAGCC 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1190277212 X:48906536-48906558 CACGTTACCTAGGTGGGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 81
1190277204_1190277212 14 Left 1190277204 X:48906499-48906521 CCAGGACAGCCTCATGGAGGAAG 0: 1
1: 0
2: 5
3: 69
4: 487
Right 1190277212 X:48906536-48906558 CACGTTACCTAGGTGGGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190277212 Original CRISPR CACGTTACCTAGGTGGGAGG AGG Exonic
900684716 1:3940780-3940802 CACATAACCTAGCTAGGAGGAGG + Intergenic
916714713 1:167439276-167439298 CGCGTTCCCTAGGTCCGAGGAGG + Intronic
918055875 1:181022104-181022126 CACGTTTGCTGGGAGGGAGGCGG - Intronic
922206722 1:223454721-223454743 CACAATCCCTAGGTGTGAGGTGG + Intergenic
923351242 1:233108891-233108913 CTTGTTACCTTGGTGGCAGGGGG - Intronic
924179973 1:241430793-241430815 CACTTGAGCTAGGTGGGGGGAGG - Intergenic
1062816794 10:506782-506804 CTCGTTTCCTGGGTGTGAGGTGG - Intronic
1062832182 10:613291-613313 GACGTTTTCTAGGTGGGAGGCGG - Intronic
1063981353 10:11454466-11454488 CATGTGACCCAGGAGGGAGGAGG - Intronic
1068279917 10:54854888-54854910 CAGGTTTCCTGGGTGGAAGGGGG - Intronic
1071344220 10:84676238-84676260 AATGTTACCTGGGTGAGAGGGGG + Intergenic
1075110446 10:119576416-119576438 CTCATTACCTAGGTGGAAAGGGG - Intronic
1076699653 10:132264783-132264805 CGAGTTTCCTCGGTGGGAGGTGG + Intronic
1087531331 11:99386156-99386178 GACATTACCCAGGTTGGAGGTGG - Intronic
1087712211 11:101567164-101567186 CACTCTAGCTAGGTGGGGGGAGG + Intronic
1088338458 11:108735580-108735602 CAAATTACCTATGGGGGAGGAGG - Intronic
1089920285 11:122203152-122203174 GACGGTGCCTGGGTGGGAGGAGG + Intergenic
1102492389 12:113297161-113297183 CAGGGTACCATGGTGGGAGGAGG - Exonic
1103400373 12:120639877-120639899 CAAGTTACCCAGATGGTAGGTGG + Intergenic
1105355112 13:19652728-19652750 CACTTGAGCTTGGTGGGAGGAGG + Intronic
1107585963 13:41848592-41848614 CACCTTCACTAGGTGGCAGGAGG - Intronic
1119184713 14:72631925-72631947 GACGTTAGCTAGGTGGGAAGAGG + Intronic
1123033693 14:105463169-105463191 CACGGGAGCTGGGTGGGAGGAGG - Exonic
1123495286 15:20817245-20817267 GAGGTTCCCTCGGTGGGAGGTGG + Intergenic
1123551775 15:21386338-21386360 GAGGTTCCCTCGGTGGGAGGTGG + Intergenic
1126383133 15:48068226-48068248 CCCGTCACATAGGTGGGAGGTGG + Intergenic
1128199301 15:65791642-65791664 CCCGTTACGTAAGTCGGAGGTGG - Intronic
1128549568 15:68589750-68589772 AACTTAACCTAGATGGGAGGAGG + Intronic
1129622275 15:77158952-77158974 CATTTTATTTAGGTGGGAGGTGG + Intronic
1202960120 15_KI270727v1_random:113580-113602 GAGGTTCCCTCGGTGGGAGGTGG + Intergenic
1134057224 16:11178223-11178245 CTGGTGAGCTAGGTGGGAGGTGG - Intronic
1136299798 16:29326497-29326519 CCCTTTACCAAGGTGCGAGGTGG - Intergenic
1142248657 16:88981079-88981101 CACTTTACAGAGGAGGGAGGAGG + Intergenic
1147373192 17:40008033-40008055 CACGTTTCCATGGTGGGAGCAGG + Intergenic
1156010286 18:32489355-32489377 CAAGTTTTCTAGGTGGCAGGAGG - Intergenic
1158249867 18:55475843-55475865 CCTGTGACCTAGGTGGGAGTGGG + Intronic
1159378199 18:67621504-67621526 CACATTACCTAGGTGTGGGTGGG + Intergenic
1160797834 19:953965-953987 CAGGAGACCGAGGTGGGAGGTGG + Intronic
1161778330 19:6275935-6275957 CACGTTCTCCAGGGGGGAGGGGG + Intronic
925296741 2:2782075-2782097 CAAGTCACCTGGGAGGGAGGCGG - Intergenic
925330135 2:3052200-3052222 CACATGGCCTAGGTGGGAGGTGG - Intergenic
931550518 2:63440853-63440875 CATGATGCCTAGGTGGGTGGGGG - Intronic
932745199 2:74328280-74328302 CATGTGACCAAGGTGGGGGGAGG + Intronic
932751390 2:74373870-74373892 CACTTTACCAGGGTGGGATGGGG - Intronic
943703321 2:191010286-191010308 CATGTTTCCAGGGTGGGAGGTGG - Intronic
947492123 2:230603938-230603960 CACTTGAGCTTGGTGGGAGGAGG + Intergenic
1170571336 20:17634478-17634500 CAAGTGACCTAGGAGGGAGGCGG + Intronic
1174124000 20:48289364-48289386 CAAGTCACATAGTTGGGAGGTGG - Intergenic
1179175273 21:39003527-39003549 CACGTTCCCTATCTAGGAGGAGG + Intergenic
1182291882 22:29286398-29286420 CACGGTGCCCAGCTGGGAGGGGG - Intronic
1184784253 22:46664188-46664210 CACCTTCCCAGGGTGGGAGGTGG + Intronic
955973368 3:64458100-64458122 CAGGTCACCTAGGGGGGTGGGGG + Intergenic
956758656 3:72416561-72416583 AAGGTTACCTTGGTGGGAAGAGG - Intronic
963892542 3:150652072-150652094 CACTGTACCAAGGTGGGGGGTGG - Intergenic
965427955 3:168550631-168550653 CTCGTGAGGTAGGTGGGAGGGGG + Intergenic
968456753 4:704295-704317 CACGTTATCCGGGTGGGAGGAGG - Intergenic
969666119 4:8558414-8558436 CACGTTTCCAGGGTGGGAGTTGG + Intergenic
969869329 4:10094978-10095000 CTAGTTACCCAGGTGGGAGAGGG - Intronic
977356623 4:95954300-95954322 CCCAATACCTAGGTTGGAGGAGG - Intergenic
978735987 4:112085130-112085152 AACGTTATTTAGGAGGGAGGGGG - Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
982842255 4:160204836-160204858 AAGGTTACATAGCTGGGAGGTGG + Intergenic
991925475 5:71701565-71701587 CACGTGTCCTGGGTGGCAGGAGG + Intergenic
997675762 5:135711935-135711957 CAGGATGCCTGGGTGGGAGGGGG - Intergenic
1009762809 6:68029553-68029575 CACCTTGCCTGGCTGGGAGGAGG - Intergenic
1013865086 6:114686926-114686948 CACGTTACCTAGGTGTTTGTAGG + Intergenic
1026466814 7:70661431-70661453 CAGGTGACCAGGGTGGGAGGAGG + Intronic
1027240177 7:76322220-76322242 CACGTTACAAAAGTGTGAGGCGG - Intergenic
1029801437 7:102951690-102951712 CTAGCTACTTAGGTGGGAGGTGG + Intronic
1048965082 8:139609248-139609270 CACGCTAGGTAGGTGGGGGGGGG - Intronic
1053446334 9:38155929-38155951 CAACTTACCAAGGTGCGAGGTGG + Intergenic
1053683425 9:40499806-40499828 CAGGTTCCCTGGGTGGGAAGGGG + Intergenic
1054280290 9:63125122-63125144 CAGGTTCCCTGGGTGGGAAGGGG - Intergenic
1054296528 9:63335304-63335326 CAGGTTCCCTGGGTGGGAAGGGG + Intergenic
1054394546 9:64639809-64639831 CAGGTTCCCTGGGTGGGAAGGGG + Intergenic
1054429195 9:65145008-65145030 CAGGTTCCCTGGGTGGGAAGGGG + Intergenic
1054501189 9:65876527-65876549 CAGGTTCCCTGGGTGGGAAGGGG - Intergenic
1056832298 9:89927053-89927075 CTGGTTCCCAAGGTGGGAGGTGG + Intergenic
1060103577 9:120860006-120860028 CACATTACAGAAGTGGGAGGTGG + Intronic
1060495372 9:124114673-124114695 TATGTTACCTGGGTGGGTGGGGG - Intergenic
1060533898 9:124367476-124367498 TCTGTTACTTAGGTGGGAGGAGG + Intronic
1061321976 9:129836417-129836439 CAAGTTACCCAGCTAGGAGGTGG + Intronic
1061383546 9:130275149-130275171 CTAGTTTCCTAGGTGGGAGATGG + Intergenic
1062017355 9:134297418-134297440 CACGTTCCCTGGCTGAGAGGTGG + Intergenic
1190277212 X:48906536-48906558 CACGTTACCTAGGTGGGAGGAGG + Exonic
1190867728 X:54398867-54398889 CGGGAGACCTAGGTGGGAGGAGG - Intergenic
1199687528 X:150277704-150277726 CCCGTTATTAAGGTGGGAGGTGG - Intergenic
1200843281 Y:7805487-7805509 GACTTTACCTAGGTGGGTGCTGG + Intergenic