ID: 1190277828

View in Genome Browser
Species Human (GRCh38)
Location X:48910664-48910686
Sequence GATCCTCCTCATACCCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190277823_1190277828 13 Left 1190277823 X:48910628-48910650 CCTCACACTGAGAATGGCCTACA 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1190277828 X:48910664-48910686 GATCCTCCTCATACCCAGAATGG 0: 1
1: 0
2: 1
3: 9
4: 111
1190277825_1190277828 -4 Left 1190277825 X:48910645-48910667 CCTACATCCCATATGGAATGATC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1190277828 X:48910664-48910686 GATCCTCCTCATACCCAGAATGG 0: 1
1: 0
2: 1
3: 9
4: 111
1190277822_1190277828 14 Left 1190277822 X:48910627-48910649 CCCTCACACTGAGAATGGCCTAC 0: 1
1: 0
2: 1
3: 13
4: 104
Right 1190277828 X:48910664-48910686 GATCCTCCTCATACCCAGAATGG 0: 1
1: 0
2: 1
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190277828 Original CRISPR GATCCTCCTCATACCCAGAA TGG Intronic
900390701 1:2432627-2432649 GACCCTCATCATGCCCAGCAGGG - Intronic
902670336 1:17968761-17968783 GCTGCTCCTCAGACCCAGATGGG + Intergenic
905221121 1:36448624-36448646 AATCCTCCCCATATGCAGAAAGG - Intronic
906205589 1:43984847-43984869 GCTCCTCCCCCTACCCAGCATGG + Exonic
907487276 1:54786762-54786784 GACCCTCCCCATACCCAGTCTGG - Intronic
912517429 1:110225118-110225140 GATTCTCTTTATACCCTGAATGG - Intronic
912574437 1:110652900-110652922 GATCCTCTTTAGATCCAGAATGG - Intergenic
916557679 1:165907484-165907506 GATCCTCCTCCTTCACAGGAGGG - Intronic
918033424 1:180840461-180840483 GATCCTCTTCATACCCTAATTGG + Intronic
923196933 1:231677576-231677598 GATAATCCCCATACCCTGAAAGG - Intronic
1064103581 10:12483152-12483174 GATGCTCCACAAACACAGAATGG - Intronic
1064399743 10:15011727-15011749 ATTCTTCCTCATATCCAGAAAGG + Intergenic
1069872873 10:71543784-71543806 GATCCTCCACATCCCCACATGGG - Intronic
1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG + Intergenic
1076192979 10:128495866-128495888 GCTCATCTTCATACCCAGCATGG + Intergenic
1082826007 11:57579366-57579388 GAGCCTCCTCCAACCCAGACAGG - Intergenic
1083322374 11:61855545-61855567 GATCTCACTCATTCCCAGAAAGG - Intronic
1084654544 11:70507537-70507559 CCTCCTCCTCATGCTCAGAAAGG - Intronic
1089203543 11:116740222-116740244 GATCCTCTCAATAACCAGAAAGG + Intergenic
1090885881 11:130876356-130876378 GATCCTCCTTCTACCCAGGAGGG - Exonic
1098195994 12:68002807-68002829 GATTATCCTCAAACCCAGGAAGG - Intergenic
1114917750 14:27288835-27288857 AGTCCTCCTCAACCCCAGAATGG - Intergenic
1118543865 14:66862630-66862652 GATCATTCTCATAACCAAAAGGG + Intronic
1119535995 14:75402831-75402853 GATACTCCCCAAACACAGAAAGG - Intergenic
1119759856 14:77142488-77142510 CAACCTCCTCATCTCCAGAATGG - Intronic
1123196199 14:106618812-106618834 GATGCTCCTCATAACCACAAAGG - Intergenic
1125303262 15:38280346-38280368 GATTCTCATGATAGCCAGAAGGG + Intronic
1127840317 15:62826097-62826119 GATCCTTCACAGACACAGAAAGG + Intronic
1129021191 15:72520413-72520435 GACACTCCTAAAACCCAGAAAGG - Intronic
1129651772 15:77496115-77496137 GCCCCTCCTCCCACCCAGAAAGG - Intergenic
1129912910 15:79242971-79242993 GAACACCCTCACACCCAGAATGG - Intergenic
1130163049 15:81421303-81421325 AATCCTCCTTAGAACCAGAAGGG + Intergenic
1136686739 16:31999425-31999447 AATCCTCCTCAGGCCTAGAAGGG + Intergenic
1137510285 16:49093724-49093746 GAGTCTCCTCATCCACAGAATGG + Intergenic
1138993556 16:62420992-62421014 GATACTTCTCATACCTAGGACGG + Intergenic
1144316160 17:14063366-14063388 GGTGCCCCTCATCCCCAGAAAGG - Intergenic
1153424728 18:4949699-4949721 CATCCTCCTGATACCAAAAACGG + Intergenic
1157147415 18:45178032-45178054 GATTCTACTCATACCCAGGAAGG + Intergenic
1158509337 18:58076700-58076722 GATCCTGCTGATCTCCAGAATGG + Intronic
1160406860 18:78652341-78652363 GATCCTCCTCTGACACAAAAGGG - Intergenic
1162383072 19:10343333-10343355 GGTTCTCCTCATTCCCACAAAGG + Intergenic
1165578657 19:36843439-36843461 GATCCTCCTGAAACCCTGATGGG + Intronic
1165948480 19:39459176-39459198 GATCCTCCATACACCCTGAAGGG - Exonic
1168720273 19:58550887-58550909 GACCCTCCCCATACCCAGAAAGG - Intergenic
926104785 2:10143306-10143328 GAACCTCCTCAGACCCAGTGAGG + Intronic
928254919 2:29713926-29713948 GATTCTTCCCATACCCAGAGTGG + Intronic
929164001 2:38862305-38862327 CATCTTCCTCCTCCCCAGAAAGG + Exonic
929888343 2:45898569-45898591 GATCCTCAGCATAACCAGATAGG - Intronic
929963927 2:46519481-46519503 CATCCTCTTCATGCCCAGACAGG + Exonic
930737026 2:54789700-54789722 TATCCTCATGATATCCAGAAGGG + Intronic
932350349 2:71026020-71026042 ATTCTTCCTCATATCCAGAAAGG - Intergenic
937111846 2:119372699-119372721 CATCCTCCTCCTCCCCACAAAGG - Intergenic
937230506 2:120395768-120395790 GATTCTCCTCTTAGCCTGAAGGG + Intergenic
940874782 2:158887773-158887795 GTTCTTCCTAATATCCAGAAAGG - Intergenic
942622606 2:177863640-177863662 GATACACCTCATACCCATTAGGG + Intronic
943632967 2:190274859-190274881 CATCCTTCTCTTCCCCAGAAAGG + Intronic
945365042 2:208942196-208942218 GAACCTCCTTATGCCCAGAGAGG + Intergenic
1171567481 20:26208641-26208663 GATCCTCCCCTTACTCGGAAAGG + Intergenic
1172265674 20:33611111-33611133 CATTCTCCTCCTACCCTGAATGG + Exonic
1175989968 20:62783729-62783751 TTTCCTCCTCAAGCCCAGAAGGG + Intergenic
1176127341 20:63481933-63481955 GTTCCTCCCCACACCCTGAAGGG + Intergenic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1182432758 22:30310052-30310074 GATCCTCCTCTCACCCATAGGGG + Intronic
1184761184 22:46545541-46545563 GCTCCTCCCTATACCCAGCAGGG - Intergenic
950036797 3:9891787-9891809 TATCCTCCTCATATCCCTAAAGG - Intronic
952684122 3:36130235-36130257 GATCTTCCTCAAACAAAGAAAGG - Intergenic
953152491 3:40337624-40337646 GAGGCTCCTCCTACCCAGACTGG + Intergenic
960301217 3:116005227-116005249 GAATCTCTTCAAACCCAGAAAGG + Intronic
960574626 3:119217904-119217926 GGGCCTCCTGACACCCAGAATGG + Intronic
960739437 3:120816843-120816865 GATCCTCTCCAAACCCAGCAGGG - Intergenic
961210420 3:125120884-125120906 GAGCCTCCTCCAACCCACAAAGG - Intronic
961272638 3:125700455-125700477 GTTCTTCCTAATATCCAGAAAGG - Intergenic
961727074 3:128938364-128938386 GAACTTCCTCAGACCCATAAAGG + Intronic
964983571 3:162714136-162714158 TACCCTCCTCATACCCAGTCTGG + Intergenic
965129263 3:164673925-164673947 GATCCTCTTCTTTCCCAGCAGGG + Intergenic
965668902 3:171126049-171126071 GAGCCTCCTGAAACCCAGAGAGG + Exonic
967289430 3:187904693-187904715 CATCCTCCTCATTCCCAAAGTGG + Intergenic
968988349 4:3892087-3892109 TATTCTCCTAATATCCAGAAAGG + Intergenic
969786010 4:9457431-9457453 GTTCTTCCTAATATCCAGAAAGG - Intergenic
974768919 4:66385128-66385150 GATCTGCCTCATACCGAGAGTGG - Intergenic
977708343 4:100096252-100096274 GATTCTCCTGAAACCCAGAAAGG - Intergenic
980114418 4:128665538-128665560 GATCCACATCAAACTCAGAATGG + Intergenic
981579360 4:146236587-146236609 CATCCTCCTCATTCCCAGGGTGG - Intergenic
981715414 4:147747065-147747087 AACCCTCATGATACCCAGAAAGG + Intronic
986733484 5:10651909-10651931 GTTCCTCCTTAATCCCAGAAGGG + Intergenic
987069614 5:14323354-14323376 CATCCTCCTCAGACCCAGAGCGG - Intronic
987280989 5:16413508-16413530 GATGTTCCTCATATTCAGAAGGG - Intergenic
987909820 5:24126791-24126813 CATCCTCCTGATACCCAAACTGG - Intronic
996445938 5:123550375-123550397 GTTCCTCCTCACTTCCAGAAAGG - Intronic
997426224 5:133804574-133804596 GATCTGCATGATACCCAGAAAGG + Intergenic
998522987 5:142817389-142817411 TTTCCTCCTCTTACCCTGAAAGG - Intronic
1004951567 6:20678925-20678947 GGTCTTCCTCATACCCAGTCTGG + Intronic
1007549199 6:42716092-42716114 GATCCTCCTCTGACACAGACTGG - Intronic
1011856267 6:91695524-91695546 AATGCTCATCATACCCACAAAGG + Intergenic
1018102921 6:160457210-160457232 GACCCCATTCATACCCAGAAGGG - Intergenic
1018124585 6:160669489-160669511 GACCCCACTCATACCCAGAAGGG - Intergenic
1019595515 7:1856646-1856668 GCTCCTCCACAAACCCAGAAGGG + Intronic
1022469720 7:30674803-30674825 AATCCTGCTCACACCAAGAATGG - Intronic
1026929982 7:74218377-74218399 GCTCCTCCTCTGAACCAGAATGG - Intronic
1035590693 8:811270-811292 GTTCCTGCTCATTCCCAGGAAGG - Intergenic
1037622207 8:20574329-20574351 TCCCTTCCTCATACCCAGAAAGG - Intergenic
1039439795 8:37587180-37587202 GTTCCTCCTCAGACTCAGAGTGG + Intergenic
1042509833 8:69599261-69599283 GATCCTCCTCAGACAGAGATTGG + Intronic
1046333800 8:112756172-112756194 GATTTTTCACATACCCAGAACGG - Intronic
1047711923 8:127561138-127561160 AATCCTCATCTGACCCAGAAGGG + Intergenic
1047929053 8:129708495-129708517 GAACCTCCTAGAACCCAGAAAGG + Intergenic
1048857578 8:138697605-138697627 GAGCCTCCTCAGTCCCAGAGAGG + Intronic
1049678016 8:143901950-143901972 GATCCTTCCCATGCCCAGAGAGG + Intergenic
1050881874 9:10710752-10710774 GATCATCCAAATACCCATAATGG - Intergenic
1052164046 9:25300193-25300215 GGGCCTCCTCACACTCAGAAGGG + Intergenic
1053478766 9:38400807-38400829 GGTCAGCCTCACACCCAGAATGG - Intergenic
1055096434 9:72419186-72419208 GATCTTCCTAAGGCCCAGAAAGG + Intergenic
1056916785 9:90753661-90753683 ATTCTTCCTCATATCCAGAAAGG + Intergenic
1057799906 9:98184640-98184662 GTTCCTCCTCATCCTCAGAGTGG + Intronic
1062677408 9:137755007-137755029 AAATCTCCTCAAACCCAGAAGGG + Intronic
1187194649 X:17071583-17071605 GAACTCCCTCATACCCAGAGAGG - Intronic
1190277828 X:48910664-48910686 GATCCTCCTCATACCCAGAATGG + Intronic
1190284448 X:48952960-48952982 GTTCTTCCTCTTGCCCAGAATGG - Intronic
1190439085 X:50458932-50458954 TATCCCCCTCAAACCCAGAGAGG - Intronic
1190731935 X:53232361-53232383 GCTCCTCCTCATCCCCACAATGG - Intergenic
1196480641 X:116142816-116142838 CATCCTCCTCTTAAGCAGAAAGG - Intergenic
1196687688 X:118526287-118526309 AGTCCTCCTCATACCGAGCATGG + Intronic