ID: 1190279534

View in Genome Browser
Species Human (GRCh38)
Location X:48920227-48920249
Sequence GAAGATGCACAGATGCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190279530_1190279534 9 Left 1190279530 X:48920195-48920217 CCCAGAAATGAGAGACGCAGAGT 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1190279534 X:48920227-48920249 GAAGATGCACAGATGCTCCAGGG 0: 1
1: 0
2: 2
3: 28
4: 258
1190279531_1190279534 8 Left 1190279531 X:48920196-48920218 CCAGAAATGAGAGACGCAGAGTC 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1190279534 X:48920227-48920249 GAAGATGCACAGATGCTCCAGGG 0: 1
1: 0
2: 2
3: 28
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190279534 Original CRISPR GAAGATGCACAGATGCTCCA GGG Intergenic
900678920 1:3905455-3905477 GAAGATGCCCAGAAACTTCAGGG + Intergenic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
902516066 1:16990211-16990233 GACGATGATCAGATGCTCCTGGG + Exonic
902541364 1:17157690-17157712 GAAAATGGACAGATGACCCAAGG - Intergenic
902769770 1:18638919-18638941 GGAGAGGCAGAGATGCCCCATGG + Intronic
904306857 1:29595370-29595392 GAAGGAGCACAGATGCACCCTGG - Intergenic
904458093 1:30659138-30659160 GAAGAGGCACAGATGTCCCCAGG + Intergenic
904536342 1:31202010-31202032 GAAGGTGAGCAGATGCTCCCTGG - Intronic
906314500 1:44777468-44777490 GAAGACGAACTGATGCCCCATGG + Intronic
907128973 1:52077962-52077984 GAAGATGCCCAGAATCTCCTGGG - Intronic
909085691 1:71167702-71167724 GAAGCTGCACAGATCCTGCTTGG + Intergenic
909210648 1:72818194-72818216 GAAGATTCACAGAGACTCCAGGG + Intergenic
915102975 1:153513908-153513930 CAAGATGAACAGATGGTCCAAGG + Intergenic
917293228 1:173492916-173492938 GTTGACACACAGATGCTCCAAGG + Intergenic
919247676 1:195009623-195009645 GAAGCTTCACAAATGCTTCAAGG + Intergenic
919302968 1:195793539-195793561 GCAGATTCACAGAGACTCCAAGG + Intergenic
922599536 1:226839041-226839063 GAAGGTGCACAGATGGGCCTAGG + Intergenic
923462844 1:234222177-234222199 GAAGATGCACAGCTTCTCTTTGG - Intronic
923537956 1:234867543-234867565 GAACATGCAGAGATTCTCCCTGG - Intergenic
923887483 1:238175438-238175460 GCAGATTCACAGATACTCCAGGG - Intergenic
924950779 1:248881104-248881126 GAAGGTTCTCAGATACTCCACGG - Intergenic
1063347394 10:5324820-5324842 ACAGAGGCACAGGTGCTCCAGGG + Intergenic
1063479919 10:6366440-6366462 GCAGATTCACAGAGACTCCAGGG - Intergenic
1069485563 10:68820581-68820603 GAAAATGTACATATGCACCATGG - Intergenic
1069783200 10:70969646-70969668 GAAGATGCACAGGGTTTCCAAGG - Intergenic
1070058236 10:72955418-72955440 CAAGATCTACAGATGGTCCAAGG + Intergenic
1071084370 10:81850959-81850981 GAACATGAAAAGATGCTCAATGG - Intergenic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1074124419 10:110516768-110516790 AAAAATGCACAGATACTTCAAGG - Intergenic
1074183374 10:111081985-111082007 GAAGATGAGGAGATGCTGCATGG - Intergenic
1075127778 10:119714410-119714432 GAACAGGCACAGATCCTCCTGGG + Intergenic
1075323295 10:121509852-121509874 GCAGAAGCAAAGATGTTCCAGGG + Intronic
1075671831 10:124268241-124268263 GGAGACAGACAGATGCTCCATGG + Intergenic
1075933980 10:126324019-126324041 GCAGATGCCCACATGCTCCTTGG + Intronic
1076706090 10:132302423-132302445 CAAGCTGCACAGCTGCCCCAAGG + Intronic
1077386557 11:2271982-2272004 GAAGGTGACCAGATGCTCCTGGG + Intergenic
1077402437 11:2365889-2365911 GAAGAAGCAAGGAGGCTCCAAGG + Intergenic
1077878781 11:6330861-6330883 GCAGATTCACAGAGACTCCAGGG + Intergenic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1082213497 11:49536106-49536128 TCTGATGCTCAGATGCTCCAGGG - Intergenic
1082698942 11:56403387-56403409 GCAGATTCACAGAGACTCCAAGG + Intergenic
1082702619 11:56451724-56451746 GAAAATGTACAGATACGCCATGG - Intergenic
1082956756 11:58878144-58878166 GCAGATTCACAGAGGCTCCAGGG - Intronic
1085351186 11:75798740-75798762 GAGGATGCGCAGGTGCTCTAGGG + Intronic
1086578591 11:88369906-88369928 GAAGATGTACTGATGCTTCAAGG - Intergenic
1086636111 11:89088327-89088349 TTTGATGCTCAGATGCTCCAGGG + Intergenic
1087440510 11:98177597-98177619 GAGGATGGACAGACGCTGCATGG + Intergenic
1087525025 11:99298254-99298276 GCAGATTCACAGAGACTCCAGGG + Intronic
1088723273 11:112612849-112612871 CCAGGTGCACAAATGCTCCAGGG + Intergenic
1090397288 11:126427416-126427438 GAAGGTGCACAGCTCCGCCAGGG + Intronic
1093001780 12:14005191-14005213 GAAAAAGCACAGATGATCTAAGG - Intergenic
1093773136 12:23040290-23040312 GATTATGCACAGATGCTATAAGG - Intergenic
1094502844 12:31036145-31036167 GAAGATGCACTGCTGCTGCTGGG - Intergenic
1096904603 12:54923422-54923444 GCAGATTCAGAGAGGCTCCAGGG + Intergenic
1096912607 12:54999204-54999226 GCAGATTCAGAGAGGCTCCAGGG + Intergenic
1097253924 12:57657660-57657682 GCAGATTCACAGAGACTCCAGGG - Intergenic
1098094037 12:66935661-66935683 GCAGATTCACAGAGACTCCAGGG + Intergenic
1098193737 12:67977725-67977747 GAAAATGGACACATTCTCCATGG - Intergenic
1101188235 12:102304519-102304541 GCAGATACACAGAGACTCCAGGG - Intergenic
1102551309 12:113694117-113694139 GGAGAGGGACAGATGCTACATGG - Intergenic
1104334590 12:127881487-127881509 GAAGATTCACTGATGCCACAGGG + Intergenic
1104732542 12:131115938-131115960 GTAGATGCACAGCTGGTCCCGGG + Intronic
1104766704 12:131334310-131334332 GAGGATGCACAGAGACCCCAGGG + Intergenic
1105774359 13:23643717-23643739 GAAGGTGCGAAGATCCTCCATGG + Intronic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1107272493 13:38636306-38636328 GCAGATTCACAGAGACTCCAGGG - Intergenic
1107637937 13:42411930-42411952 GAATCTGCAGAGTTGCTCCAGGG - Intergenic
1108712924 13:53051730-53051752 TAAGTTGCACATATGCTCCAAGG - Exonic
1109768563 13:66937863-66937885 GCAGATTCACAGAGACTCCAGGG - Intronic
1112951637 13:105004876-105004898 AAAGATGCATATATACTCCAAGG + Intergenic
1112990308 13:105505508-105505530 GCAGACTCACAGAGGCTCCAGGG + Intergenic
1113114063 13:106856058-106856080 GCAGATTCACAGAATCTCCAGGG + Intergenic
1113236987 13:108288324-108288346 AAATATGCACAAATGCTCCTTGG + Intronic
1114416807 14:22550399-22550421 GGATATGCACAGAAGCTGCAAGG + Intergenic
1114733148 14:25015989-25016011 GAAGCTGCACAGTGTCTCCAAGG - Intronic
1116081623 14:40180934-40180956 GAAGATGCTCAGATACCTCAGGG - Intergenic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1119363464 14:74071261-74071283 CAAGAAGCATAGTTGCTCCAGGG + Exonic
1121213165 14:92224778-92224800 GCAGATTCACAGAGACTCCAGGG - Intergenic
1121718580 14:96093409-96093431 GAAGATGCAGATTTGCTCAAAGG - Exonic
1122364192 14:101184530-101184552 GAAAATGGACAAAGGCTCCAAGG - Intergenic
1123151355 14:106184998-106185020 AACTATGCACAGAAGCTCCAGGG - Intergenic
1123583233 15:21735607-21735629 AAATATTCACAGAAGCTCCAGGG - Intergenic
1123619883 15:22178204-22178226 AAATATTCACAGAAGCTCCAGGG - Intergenic
1124091483 15:26607165-26607187 GTAGATTCACAGAGACTCCAGGG - Intronic
1124231022 15:27946566-27946588 GCAGATTCACAGAGACTCCAGGG - Intronic
1124892787 15:33748303-33748325 GAACATTCCCAGATTCTCCATGG - Intronic
1126608466 15:50504571-50504593 CAAAATCCACAGATGCTCAAGGG - Exonic
1127222083 15:56890458-56890480 GAAGAAGCACAGATGTGCCCTGG + Intronic
1128514149 15:68331779-68331801 GATGAGGCACAGAAGCTCCTGGG + Intronic
1128753047 15:70162562-70162584 GAAGGTGCAATGATGCCCCAAGG - Intergenic
1128991170 15:72261616-72261638 GAAGAGGCACAGTTGGTTCAAGG - Exonic
1129669424 15:77598898-77598920 GAAGAAGCCCAGAGGCTCCACGG + Intergenic
1130193424 15:81757641-81757663 GTAGATTCACAGAGACTCCAAGG - Intergenic
1131004023 15:88961157-88961179 GAAGGTGAACATATTCTCCAAGG + Intergenic
1133757474 16:8773001-8773023 GGAGATTGACAGAAGCTCCAAGG - Intronic
1134347597 16:13405383-13405405 GAAGATAGAAAGATGCTCCCTGG + Intergenic
1134631295 16:15757971-15757993 GTTGATGCACAGCTGCTCGAAGG + Exonic
1135790049 16:25385603-25385625 AAATATGCACATATACTCCATGG - Intergenic
1137543454 16:49380487-49380509 CAAGATTTACAGAAGCTCCAGGG - Intronic
1138104889 16:54282626-54282648 CAAGACGCACAGATGCTCCCAGG + Intergenic
1138228911 16:55323940-55323962 GCAGCTGCAGAGAAGCTCCAAGG + Exonic
1138794656 16:59953307-59953329 GCAGATGGGCAGAGGCTCCATGG + Intergenic
1138883733 16:61049644-61049666 GAAGATCATCAGATTCTCCAAGG - Intergenic
1139165068 16:64556442-64556464 GCAGATTCACAGATACTCCAGGG + Intergenic
1139260020 16:65582636-65582658 GAACATGAAAAGAAGCTCCAGGG + Intergenic
1139262920 16:65612456-65612478 GCAGATGAACAAATGTTCCAGGG - Intergenic
1141348113 16:83267233-83267255 GAAGGTGCAGGGAAGCTCCAGGG + Intronic
1142276788 16:89123021-89123043 GAAGCCGCACAGATGCTCTGGGG + Intronic
1143405849 17:6676817-6676839 GATCATGCACAGGTGCCCCATGG + Intergenic
1144620789 17:16817264-16817286 CAAGTTGCCCAGATGGTCCATGG - Intergenic
1144679640 17:17184386-17184408 GAGGAGGACCAGATGCTCCAGGG - Intronic
1147572178 17:41578167-41578189 CAAGTTGCCCAGATGGTCCATGG - Intergenic
1147874841 17:43613829-43613851 GAACTTGCACAGGTGCTCAAGGG + Intergenic
1147875280 17:43616615-43616637 GGAGATGCTCAGCAGCTCCAAGG + Intergenic
1149530554 17:57391593-57391615 GAAGATGCACAGATGACTCACGG - Intronic
1152884307 17:82840481-82840503 GAAGGTCCACAGATCCTCAAAGG - Exonic
1152884603 17:82842216-82842238 GAAGGTACACAGATTCTCAAAGG - Intronic
1153699781 18:7680911-7680933 GAACTTGCCCAGATGCTTCAAGG + Intronic
1156030264 18:32704925-32704947 GAAGAGCAATAGATGCTCCAGGG + Intronic
1157731928 18:50011487-50011509 GAAGGTGCACAGGCGCTCCAAGG + Intronic
1158350597 18:56561674-56561696 GAAGATGCTCAAATGCTCCAAGG + Intergenic
1162350730 19:10147671-10147693 GGAGAAGCACAGATGCCCCCGGG + Intronic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925864761 2:8217763-8217785 GAAGAGGCTCAGCTGTTCCATGG - Intergenic
928277729 2:29918276-29918298 GAAGCTCCACAGATGCTCAGAGG + Intronic
929792506 2:45034090-45034112 CAAGGTGCACACATCCTCCAAGG - Intergenic
931119986 2:59205711-59205733 GAAAATGCAAATATGCTCAATGG + Intergenic
935377898 2:102419316-102419338 TATGATTCTCAGATGCTCCATGG - Intronic
936692561 2:114909416-114909438 GGAGATTCACAGATGCCTCAAGG - Intronic
936828987 2:116617906-116617928 GCAGATCCACCGAGGCTCCAAGG - Intergenic
938669612 2:133574337-133574359 TAACATGCAAAGATGCCCCAGGG + Intergenic
940789850 2:158020575-158020597 GAAGAAGGACAGATGCAACATGG + Intronic
944376189 2:199044954-199044976 GCAGATTCACAGAGACTCCAGGG + Intergenic
945163535 2:206918518-206918540 GCAGATGCACAGATGCATAAGGG - Intergenic
947818910 2:233057347-233057369 GAGGTTGACCAGATGCTCCAAGG + Intergenic
948082250 2:235215926-235215948 GAAGATGAACAGATTATTCAGGG + Intergenic
948187980 2:236036132-236036154 GTAGATCCACAGACACTCCATGG - Intronic
949077917 2:242073199-242073221 GAGCATGCCCAGATGCTCCAGGG + Intergenic
1171349759 20:24493670-24493692 GAAGATGCTCAAATGCTCAGTGG + Intronic
1172287345 20:33750094-33750116 GAAAATGCACAGTAGCTCCCTGG + Intronic
1174212380 20:48890191-48890213 GATGATGCTCACATGCTCCCAGG - Intergenic
1174548789 20:51345994-51346016 GATGAGTCACAGAGGCTCCAGGG + Intergenic
1177198161 21:17924456-17924478 GAAAGTGCACAGCTGCTCCATGG - Intronic
1177748245 21:25247526-25247548 GCAGATTCACAGAGACTCCAGGG + Intergenic
1178330209 21:31683732-31683754 AAAGATGCAAAGATGTTCCCTGG + Intronic
1178497684 21:33101295-33101317 GAATATGCACAGCTCCTCCTTGG + Intergenic
1179384050 21:40925204-40925226 AGAGATTAACAGATGCTCCAGGG + Intergenic
1180709534 22:17830563-17830585 GAGCATGCACAGCTGGTCCAGGG - Intronic
1180865448 22:19116257-19116279 GAGGATGCCCAGAAGGTCCAGGG + Intronic
1183943205 22:41308294-41308316 GATGACACAGAGATGCTCCAGGG - Intronic
1184304035 22:43582927-43582949 AAAGATTCATAGATGCCCCAAGG + Intronic
950787249 3:15447026-15447048 GCAGAAGCACAGAGGCTACATGG - Intronic
952242736 3:31550278-31550300 GAAGATGCAGAGTAGCTCTAAGG + Intronic
953458428 3:43062369-43062391 GATGCTGGACAGATGCTTCAGGG + Intergenic
953982595 3:47420132-47420154 GAAGAGGCACTGCTGCCCCAAGG + Intronic
954826857 3:53381113-53381135 CAGGATACACAGATTCTCCAAGG + Intergenic
956118858 3:65945751-65945773 GCAGATTCACAGAGACTCCAGGG - Intronic
956325932 3:68053080-68053102 GAAGTTTAACAGATACTCCAGGG - Intronic
957008597 3:74979940-74979962 GAACATGAAGAGATGCTTCAGGG - Intergenic
957699572 3:83691058-83691080 GAAGTGGCACATATGCACCATGG + Intergenic
957724311 3:84045163-84045185 GAAAATTCACAGAGGCTCTAGGG - Intergenic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
960686803 3:120302992-120303014 GAAGATCCACATATGGTCAAAGG - Intergenic
961543612 3:127617313-127617335 GGAGATGCTCTGTTGCTCCATGG - Exonic
962391772 3:134978274-134978296 GAAGATGCACTGAGGGGCCAGGG - Intronic
963991386 3:151659856-151659878 GGAGCTTCACAGATCCTCCAGGG + Intergenic
964071036 3:152633762-152633784 GATGATGCAGAGATGGTCAATGG - Intergenic
964684008 3:159375256-159375278 GAAGATGCTCAGATGAGCCCAGG + Intronic
969904940 4:10385186-10385208 GCTGCTGCACACATGCTCCAGGG - Intergenic
972818760 4:42675208-42675230 GCAGATTCACAGAGACTCCAGGG - Intergenic
973064575 4:45772844-45772866 GAAAATGCACATATACCCCATGG - Intergenic
975335109 4:73167472-73167494 GAAGATTCAAAGATGTTACACGG - Intronic
975656014 4:76641877-76641899 GAAGATGGAAATATACTCCAGGG + Intronic
975811970 4:78178941-78178963 GCTGATGCACAGATGTTCGAGGG + Intronic
976302881 4:83531761-83531783 GCAGATTCACAGAGACTCCAGGG - Intergenic
976560287 4:86493203-86493225 GCAGATTCACAGAGACTCCAGGG - Intronic
978761013 4:112356548-112356570 GTGGATGCACAGCTGCTCCCGGG - Intronic
978891871 4:113839044-113839066 TAAAAGGCAAAGATGCTCCAGGG - Intergenic
981200828 4:141977844-141977866 GCAGATTCACAGAGACTCCAGGG - Intergenic
982568191 4:157013863-157013885 GCAGATTCACAGAGACTCCAGGG + Intergenic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
985614919 5:914307-914329 CAAGATGCACAGCTGCACTAGGG - Intronic
986431736 5:7688024-7688046 GTAGATGAACAGATGCTACTGGG + Intronic
986961624 5:13219827-13219849 GCAGATTCACAGAGGCTCCAGGG - Intergenic
989133158 5:38126999-38127021 GAAGAAACACAGAAGCTGCAAGG + Intergenic
989336675 5:40325725-40325747 GCAGATTCACAGAGACTCCAGGG + Intergenic
989337242 5:40332077-40332099 GCAGATTCACAGAGACTCCAGGG + Intergenic
989367812 5:40676170-40676192 GAGGATGCACAGAAACTCCCTGG - Intergenic
989642717 5:43599105-43599127 GCAGATTCACAGAGACTCCAGGG - Intergenic
990307730 5:54509527-54509549 CAAGAGACACAGCTGCTCCAGGG + Intergenic
990342655 5:54839013-54839035 GATGATGGACAGATGCACCAGGG + Intergenic
993146176 5:84096272-84096294 GAAAAGCCACAGATGCTCAAAGG + Intronic
993149651 5:84144464-84144486 GAAAATGCACAGACTCTCAAAGG + Intronic
993436733 5:87905035-87905057 GAAGATGAAAAGATGGTCCAGGG - Intergenic
994354927 5:98784152-98784174 GCAGATGGACAGATGCTCTGAGG + Intronic
994661115 5:102655584-102655606 GCAGATTCACAGAGACTCCAAGG + Intergenic
995709947 5:115025158-115025180 GAAGAGGTACAGAGACTCCAAGG + Intergenic
996538072 5:124599431-124599453 GAAGCTGAACAGAAGCTGCAGGG - Intergenic
998249372 5:140541018-140541040 CAAGATACACAGGTGATCCAAGG - Intronic
999309095 5:150540071-150540093 GAAGATGCTGATCTGCTCCAGGG - Exonic
1000501247 5:162053718-162053740 GCAGATTCACAGAGACTCCAGGG + Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1002345821 5:178546934-178546956 GAGGAGGCACAGGGGCTCCAGGG + Intronic
1003609290 6:7594459-7594481 GAAGATGGACATGTGTTCCAGGG + Intronic
1005163794 6:22896033-22896055 CAAGATTCACAGAAGTTCCAAGG + Intergenic
1006261343 6:32874151-32874173 GAAAATGTACATATGCACCATGG - Intergenic
1006483617 6:34319495-34319517 GAAGCTGCACAGAGCTTCCATGG + Intronic
1006819302 6:36878894-36878916 GCAGATTCACAGAGACTCCAGGG - Intronic
1008161084 6:48076745-48076767 GCAGATTCACAGATATTCCAGGG + Intergenic
1009279958 6:61736437-61736459 GGACATCCACAGGTGCTCCAAGG + Intronic
1009659083 6:66586754-66586776 GAAGATGGAAAGAATCTCCAGGG + Intergenic
1010175444 6:73022865-73022887 GTAGATGAACAGAAGCTCAAAGG + Intronic
1011486726 6:87850060-87850082 GCAGAAGCTCAGATCCTCCAGGG + Intergenic
1012734729 6:102924782-102924804 TAAGGGGCACAGATGCTCCATGG + Intergenic
1012771661 6:103444506-103444528 GCAGATTCACAGAAGCTCCAGGG + Intergenic
1018234748 6:161713262-161713284 GAACATGTAGAGATGCTGCAAGG - Intronic
1018873499 6:167800675-167800697 GAAGCTGGACAGAAGCTCCTGGG + Intergenic
1019192312 6:170259411-170259433 GAAGGTGCCCAGACGCCCCAGGG - Intergenic
1022384245 7:29887033-29887055 GAAGATGAGCAGATGCTGAAGGG + Intronic
1023031604 7:36094575-36094597 GAAGCTGGACGGAGGCTCCAAGG + Intergenic
1026548066 7:71341826-71341848 GATGATGAAGAGATGCTCCAGGG + Intronic
1027339225 7:77188125-77188147 GCAGATTCACAGAGACTCCAGGG - Intronic
1027833105 7:83206017-83206039 GAAGATGCAAAGGTGCTAAAAGG - Intergenic
1030104660 7:105976939-105976961 GAATTTGCATAGAGGCTCCAAGG + Intronic
1032743076 7:134759034-134759056 AAAGATCCACAGACTCTCCAAGG - Intronic
1034574913 7:151988284-151988306 CAAGCTGCTCAGATGCTCCTGGG - Intronic
1035175502 7:157047167-157047189 GAAGAAGCACAGATGACCCTCGG + Intergenic
1035536455 8:395000-395022 GAGCATGCCCAGATGCTCCAGGG + Intergenic
1035919149 8:3657889-3657911 AAATTTGCACAGAAGCTCCAGGG - Intronic
1036137177 8:6173153-6173175 TAAGATCCACAGAGACTCCAAGG + Intergenic
1036425281 8:8639974-8639996 GCAGATTCAGAGAGGCTCCAGGG - Intergenic
1036814169 8:11888703-11888725 GAAGATGGACATATCCTCTAGGG + Intergenic
1037849818 8:22318114-22318136 GAAGATGAACAAATGCTCGAAGG - Intronic
1040547322 8:48408880-48408902 GAAGATGAGCAGATGCTGCTGGG + Intergenic
1041089220 8:54286540-54286562 GCAGATTCACAGAGACTCCAGGG + Intergenic
1041868361 8:62603686-62603708 TCAGATGCACAGATGCTTCCAGG - Intronic
1042523939 8:69744614-69744636 GAAGATGTACAGATACCCCAAGG - Intronic
1043094903 8:75955344-75955366 ATATATGCACAGATGATCCATGG - Intergenic
1043512383 8:80962248-80962270 GCAGATTCACAGAAACTCCAGGG + Intergenic
1043631881 8:82345601-82345623 GCAGATTCAGAGATACTCCAGGG + Intergenic
1044903821 8:96978043-96978065 GAGGAGTCACAGATGCCCCATGG - Intronic
1045394672 8:101748979-101749001 GCGCATGCACACATGCTCCAGGG - Intronic
1045578923 8:103456997-103457019 GAAGATAGACAGATGGTTCAAGG + Intergenic
1046035247 8:108832749-108832771 GCAGATTCACAGAGACTCCAGGG - Intergenic
1047545188 8:125809746-125809768 GCAGATTCACATAGGCTCCAAGG - Intergenic
1047948993 8:129912554-129912576 AAAGATGCACAGATGCACTCTGG + Intronic
1049310888 8:141933287-141933309 GAAGATGCTCAGGTGCTCCCAGG - Intergenic
1049484458 8:142846699-142846721 GAAGATGGTCAGACCCTCCAAGG - Exonic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054808318 9:69413348-69413370 GAAGATGAACAGAACCTGCAGGG - Intergenic
1055417318 9:76097492-76097514 GAAGAAGCACAGAAGCTGTATGG + Intronic
1055970470 9:81906842-81906864 GCAGATTCACAGAGACTCCAGGG + Intergenic
1055972464 9:81925270-81925292 GCAGATTCACAGAGACTCCAGGG + Intergenic
1055974217 9:81940342-81940364 GCAGATTCACAGAGACTCCAGGG + Intergenic
1055979236 9:81985569-81985591 GCAGATTCACAGAGACTCCACGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057253832 9:93526830-93526852 GACGATGGAAAGATCCTCCAAGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058234812 9:102476572-102476594 GAAGAAGCAGGGATGCTGCAAGG + Intergenic
1059331505 9:113538538-113538560 GAAGATGGAGAGATTCTCCAAGG - Intronic
1059747943 9:117220881-117220903 GAAAATGCAGAGATGTTCCCTGG - Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1061297973 9:129687260-129687282 CAACATGCACAGATGCTTCATGG + Intronic
1061317265 9:129803968-129803990 CAAGAAGCACAGATTATCCAGGG - Intronic
1062138074 9:134940146-134940168 GTAGATGCTCAGCTGCTCCGGGG + Intergenic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1186876861 X:13825861-13825883 GAAGATGGACAGATGATGAATGG + Intronic
1188907654 X:35807602-35807624 GCAGATTCACAGAGACTCCAGGG - Intergenic
1189579714 X:42393433-42393455 TAAGATAAAAAGATGCTCCATGG - Intergenic
1189905885 X:45759026-45759048 GAGGATGTACAGAAGCCCCAGGG - Intergenic
1190279534 X:48920227-48920249 GAAGATGCACAGATGCTCCAGGG + Intergenic
1191663339 X:63672671-63672693 GAAGTTGGGGAGATGCTCCAGGG + Intronic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1192819651 X:74631134-74631156 GTAGATGCTCAGATGCTCAGTGG - Intergenic
1193275980 X:79588777-79588799 TAAGACACACAGATCCTCCAAGG - Intergenic
1194004353 X:88471987-88472009 GCAGATTCACAGAGACTCCAGGG + Intergenic
1194165480 X:90509130-90509152 GAAAATGAACAAAGGCTCCAAGG + Intergenic
1196149475 X:112356835-112356857 TAAGATGAACACATGATCCAGGG - Intergenic
1196301608 X:114054967-114054989 GCAGATTCACAGAAACTCCAGGG + Intergenic
1198401964 X:136277370-136277392 GAGGAAGCACAGATGTTCCAGGG + Intergenic
1198498081 X:137213996-137214018 GCAGATTCACAGAAACTCCAGGG - Intergenic
1198505020 X:137292849-137292871 GAAAGTGCACAGATGAGCCAAGG + Intergenic
1199951840 X:152714054-152714076 GCAGATGCGCAGATGCTCAGAGG + Intergenic
1199957843 X:152754394-152754416 GCAGATGCGCAGATGCTCAGAGG - Intergenic
1200511746 Y:4086940-4086962 GAAAATGAACAAAGGCTCCAAGG + Intergenic
1201701862 Y:16891571-16891593 GAAGATTCAGAGATACTCCATGG - Intergenic