ID: 1190283048

View in Genome Browser
Species Human (GRCh38)
Location X:48943930-48943952
Sequence GACACATTGTCAGGTGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190283048 Original CRISPR GACACATTGTCAGGTGCTAC AGG (reversed) Intronic
901211490 1:7528875-7528897 CAGACATTGTCAGCTGCTTCAGG - Intronic
902247933 1:15133945-15133967 GACACCTTGACAGGTGCATCTGG + Intergenic
903364434 1:22797355-22797377 GTCACTTTGTCAGATGCTGCTGG - Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
903473619 1:23604730-23604752 GTCACATTCTGAGGTACTACGGG - Intronic
904141269 1:28355376-28355398 GAGTAATTGACAGGTGCTACAGG - Intergenic
904932997 1:34105312-34105334 GTCACATTGGGAGGTGCTACTGG - Intronic
905842781 1:41198647-41198669 GAAAAACTGTAAGGTGCTACAGG + Intronic
910341349 1:86191933-86191955 GTCACATTCACAGGTGCTAGGGG - Intergenic
910553090 1:88498609-88498631 GCCACATTGCCTGGTGCTTCTGG + Intergenic
913414368 1:118589176-118589198 GACACATAGTCAAATACTACAGG + Intergenic
914949708 1:152101938-152101960 GACATTTTGTAAGGTGCTCCAGG + Intergenic
916023196 1:160812343-160812365 GTCACATTCTGAGGTGCTAGAGG + Intronic
917868289 1:179218761-179218783 GGCAAATTTTCAGGTGTTACAGG - Intronic
920923186 1:210315340-210315362 GGCACATTTCTAGGTGCTACTGG + Intergenic
1063707870 10:8448607-8448629 GAGAAGTTGTCAGGTTCTACAGG - Intergenic
1064005133 10:11693312-11693334 GTCACATTCTGAGGTGCTAGGGG + Intergenic
1064200414 10:13279933-13279955 GACACATTTCCAGGTTCTAAAGG + Intronic
1067215544 10:44299822-44299844 GTCACATTCTGAGGTGCTAGGGG + Intergenic
1070729784 10:78818628-78818650 GTCACATTCTCAGGTGCTGTGGG - Intergenic
1077542767 11:3155280-3155302 GACACATCTGGAGGTGCTACAGG + Intronic
1080210895 11:29783639-29783661 GACACATGGTTAGGTGCTTGTGG + Intergenic
1084087880 11:66862904-66862926 CACACAGTGTCAGGTGCTTCAGG - Intronic
1084425565 11:69082113-69082135 GACATACTGTCAGGTGGGACAGG - Intronic
1084660178 11:70542170-70542192 GTCACATTGGCAGGTGCCAGGGG - Intronic
1086190038 11:84068206-84068228 GAGACACTGTCAGGTGTTAGAGG - Intronic
1089043829 11:115481321-115481343 GCCACAGTGTCAAATGCTACAGG - Intronic
1089711064 11:120315106-120315128 TACACATTGTCAGGGGCTGGAGG + Intronic
1091635729 12:2195168-2195190 CACACATTGTCAGTTGGTCCAGG + Intronic
1091650162 12:2303644-2303666 CACACATTCTGAGGTGCTAGGGG + Intronic
1092970004 12:13684521-13684543 GAGACCTGGTAAGGTGCTACAGG + Intronic
1094603668 12:31932510-31932532 GAGATAGTGTCAGATGCTACAGG + Intergenic
1096597015 12:52702275-52702297 GACATCGTGCCAGGTGCTACAGG - Intronic
1097423273 12:59408630-59408652 GTCAGATTGCCAGGTGATACTGG + Intergenic
1098146805 12:67505950-67505972 CACACATTCTGAGGTGCTAGGGG - Intergenic
1098581841 12:72109131-72109153 GGCAATTTGTCAGGTGCTAGTGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1102004587 12:109581134-109581156 GACAGCTTGCCAGGTGCTTCTGG + Intronic
1102831321 12:116003415-116003437 GACCAATTGTCAGTTACTACTGG - Intronic
1104799747 12:131546615-131546637 GACACATGGCCAGGTGGTGCTGG - Intergenic
1107687654 13:42920163-42920185 GTCACATTCTGAGGTGCTAGGGG + Intronic
1107875435 13:44786864-44786886 GTCACATTCTGAGGTGCTAGGGG - Intergenic
1108064359 13:46562582-46562604 GTCACATTCTGAGGTGCTAGGGG + Intronic
1116550312 14:46229310-46229332 GAGACAGTGTCAGATCCTACAGG + Intergenic
1118461032 14:65987276-65987298 GTCACATTCTGAGGTACTACGGG + Intronic
1121722601 14:96121002-96121024 GACACATTTTGAGGTACTAGGGG - Intergenic
1123869192 15:24554113-24554135 CACACATTGTGAAGTCCTACAGG - Intergenic
1126462474 15:48928142-48928164 GACTCAGCCTCAGGTGCTACAGG + Intronic
1134855144 16:17512268-17512290 GACACATTCTGAGGTGCCAGGGG + Intergenic
1140571208 16:76108357-76108379 GACAGATTGTCAGCAGTTACTGG + Intergenic
1143388702 17:6547511-6547533 GGCACAGTGGCAGGTGCTACGGG - Intronic
1148878970 17:50710822-50710844 AACTCATTGCCAGGTGCTGCAGG + Intergenic
1154959328 18:21292171-21292193 GAAGCCTTGTTAGGTGCTACTGG + Intronic
1157344839 18:46818268-46818290 GCCATATTGTCAGGTGCGAATGG - Intronic
1158650731 18:59282729-59282751 GTCACATTCTGAGGTGCTGCGGG - Intronic
1159097970 18:63926449-63926471 GTCACATTCACAGGTACTACGGG + Intronic
1159915029 18:74181146-74181168 GCCACATTGTAAGGTACTAGAGG + Intergenic
1159920969 18:74227071-74227093 GTCACATTGCCAGGTACTAGGGG + Intergenic
1160313914 18:77822553-77822575 CACACATTTTCAGGTGCCATAGG - Intergenic
1162336976 19:10067817-10067839 GATACATTGTCAGGATCTGCCGG - Intergenic
1163473068 19:17508809-17508831 GACTCATTGCCAGGGGCTCCAGG + Intergenic
1168245617 19:55111985-55112007 GACACAGTTTCAGGGGCTCCTGG + Intronic
925192124 2:1893195-1893217 GAAACATTGTCATGTACTAAAGG - Intronic
927028868 2:19099828-19099850 GTCACATTGTGAGGTACTGCGGG - Intergenic
937462306 2:122100149-122100171 GTCACATTCTGAGGTTCTACAGG + Intergenic
937745460 2:125407512-125407534 GACACATTTTGAAGTGCTAATGG + Intergenic
938341227 2:130537916-130537938 GACCCATCGTCAGGGGCTCCAGG - Intergenic
938348604 2:130582793-130582815 GACCCATCGTCAGGGGCTCCAGG + Intronic
938648158 2:133352323-133352345 GGCACAGTGTCAGATGCTAGAGG - Intronic
941043026 2:160644634-160644656 GTCACATTGTAAGGTACTGCAGG - Intergenic
941309444 2:163910993-163911015 ACCACACTGTCAGGTGCCACAGG + Intergenic
941344633 2:164352357-164352379 GTCACATTGTGAGGTGCTGGGGG + Intergenic
943877511 2:193090253-193090275 GTCACATTCACAGGTGCTAGTGG - Intergenic
946319152 2:218939508-218939530 GTCACATTTGCAGGTTCTACAGG - Intergenic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1179708988 21:43201145-43201167 GTCACATTCTGAGGTACTACAGG + Intergenic
949402884 3:3684027-3684049 CACACATTGCCAGATGCTCCTGG - Intergenic
949966193 3:9358597-9358619 GACATAATGTCAGATCCTACAGG + Intronic
952212367 3:31241257-31241279 GGCACGGTGTCAGGTGCTAGGGG - Intergenic
952763345 3:36934612-36934634 GAGGCCTTGTCAGGTACTACAGG - Intronic
954787084 3:53101627-53101649 GACAGATTCTCAGGTACCACTGG - Intronic
956277413 3:67517541-67517563 GACACATAATCAGGTGCCATGGG + Intronic
956956217 3:74343833-74343855 ATCACATTCTCAGGTGATACTGG + Intronic
959909465 3:111747622-111747644 GAAACATAGTCAGAGGCTACTGG - Intronic
960942250 3:122942779-122942801 AACACATTCTCGGGTGCTGCTGG + Intronic
961173145 3:124813404-124813426 GACATAGTGTCAGGTCCCACAGG + Intronic
962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG + Intergenic
962343666 3:134604887-134604909 GACACTTAGACAGATGCTACAGG - Intronic
963123162 3:141793312-141793334 GAGACAGTGCCAGGTCCTACAGG - Intronic
966229360 3:177634357-177634379 GAAACATTGTTAGGTGGTGCAGG + Intergenic
967460832 3:189744200-189744222 GACACATTTTCATGTGCCTCAGG + Intronic
968135954 3:196219731-196219753 GCCACACTGGAAGGTGCTACTGG + Intronic
969128342 4:4971449-4971471 GAAACAGTGTCAGGTCCCACAGG + Intergenic
969472857 4:7399940-7399962 GACACATGGTCAGATTCCACCGG + Intronic
969859489 4:10024314-10024336 GTCACATTGTCAGGTACTTGGGG - Intronic
972958640 4:44423933-44423955 TACACATTTTCAGGTGCTAATGG + Intronic
973079387 4:45970942-45970964 GACAGATAGTCAGTTGCTACTGG + Intergenic
974228314 4:59078017-59078039 GTCACATTGTGAGGTACTAGAGG + Intergenic
978229786 4:106385088-106385110 GACACACTGTCTGATGCCACAGG + Intergenic
980170485 4:129283772-129283794 TAGACACTGTCATGTGCTACAGG - Intergenic
981722385 4:147814866-147814888 GACACATTCTCAGGTTCTGGGGG + Intronic
983689275 4:170448449-170448471 GTCACATTCTGAGGTGCTAGGGG + Intergenic
983968995 4:173848331-173848353 GTCACATTGTAAGGTACTAGAGG + Intergenic
985829524 5:2217892-2217914 GTCACATTCTGAGGTGCTAGGGG + Intergenic
986661594 5:10064837-10064859 GTCACATTCTGAGGTGCTAGGGG - Intergenic
986784426 5:11099304-11099326 GACACAATGACATGAGCTACAGG + Intronic
986875949 5:12109558-12109580 GTCACACTGTCAGGTCATACCGG - Intergenic
990971424 5:61510808-61510830 GGCACCTAGTCAGGTACTACTGG - Intronic
992893565 5:81227100-81227122 GAGAAAATGTCAGGTGCAACAGG - Exonic
994509376 5:100684426-100684448 GATGGATAGTCAGGTGCTACTGG + Intergenic
997695428 5:135857399-135857421 GTCACATTGGCAGCTGCTAATGG - Intronic
997725151 5:136114061-136114083 GACACTATGCCAGGTGCTAAGGG - Intergenic
998992748 5:147836569-147836591 CACATATTATCAGGTGCCACTGG - Intergenic
1000408977 5:160918160-160918182 GACACTATGTTAGGTGCTAAGGG + Intergenic
1003631217 6:7789598-7789620 GACAGGTTGGCAGGTGCTCCTGG + Intronic
1004215124 6:13695493-13695515 GACACATTGTCTGGAGCTCGAGG + Intronic
1004729638 6:18345256-18345278 GTCACATTTTGAGGTGCTAGGGG + Intergenic
1010634966 6:78247838-78247860 GACACATTCTCAGGTACTAGGGG - Intergenic
1011739536 6:90346033-90346055 AACATATTGTCAGGAGTTACAGG - Intergenic
1012935468 6:105363411-105363433 GAGAAATTGTCAGGTTCTATTGG - Intronic
1013140562 6:107329634-107329656 GTCACATTGTGAGGTACTAGGGG + Intronic
1013885049 6:114953337-114953359 GACACATTTTCATGGACTACTGG - Intergenic
1014880056 6:126712418-126712440 GACACACTGGCAGGTAGTACTGG - Intergenic
1016185995 6:141197837-141197859 GTCACATTCTGAGGTGCTAGAGG + Intergenic
1017512808 6:155129627-155129649 GACACCTTCTCAACTGCTACGGG + Exonic
1021310789 7:19093471-19093493 GTCACATTGTGAGGTACTACTGG - Intronic
1021508272 7:21408979-21409001 GAGACAGTGTCAGGTCCCACAGG + Intergenic
1021737332 7:23653002-23653024 GACATAATGTCAGGTCCCACAGG + Intergenic
1022258891 7:28685290-28685312 GTCACCCTGTCAGGTGCTAAAGG - Intronic
1022498791 7:30869721-30869743 TACACATTCTCAGGTGCTGGAGG + Intronic
1022799338 7:33760902-33760924 GAGACATTTTCAGTTGCCACAGG + Intergenic
1023280637 7:38565634-38565656 GTCACATTCTGAGGTGCTAGGGG + Intronic
1028404372 7:90460264-90460286 GAGACAATGTCAGATCCTACAGG + Intronic
1029392562 7:100285364-100285386 GACACATTGGCAGATTCTTCTGG + Intergenic
1030951981 7:115802196-115802218 GTCACATTCTAAGGTACTACAGG - Intergenic
1034337466 7:150332818-150332840 GACACATTCGCAGGTGATAGGGG + Intronic
1037843795 8:22264567-22264589 CACACTTTGTCAGGTGCTCAGGG - Intergenic
1040597446 8:48853046-48853068 GACTCAAGGTCAGTTGCTACAGG + Intergenic
1040869974 8:52090426-52090448 GTCACATTCTGAGGTGCTAGGGG + Intergenic
1041316801 8:56572376-56572398 AATACATTGACAGGTGCAACAGG - Intergenic
1044932236 8:97261209-97261231 GGCACAGTGTCCGGTGATACAGG - Intergenic
1045991596 8:108314781-108314803 GAGACAGTGTCAGGTCCCACAGG - Intronic
1047250872 8:123181511-123181533 CAGGCAGTGTCAGGTGCTACAGG - Intronic
1048552390 8:135445798-135445820 GAAACATTGTCACTTGCTAAAGG + Intergenic
1048627264 8:136198837-136198859 GTCACATTCTCAGGTACTAGGGG + Intergenic
1050556523 9:6794161-6794183 GACACTATGCCAGGTGCTAGAGG + Intronic
1053852916 9:42307994-42308016 GACAAATTGTCAGTTCCTAAGGG - Intergenic
1054571124 9:66812010-66812032 GACAAATTGTCAGTTCCTAAGGG + Intergenic
1054731651 9:68706728-68706750 AACACATTCTGAGGTCCTACCGG - Intronic
1055711322 9:79064965-79064987 TACCCATTGTTAGGTGCTAAAGG + Intergenic
1057859951 9:98633232-98633254 GGCAAAATGTCAGGTGCAACTGG + Intronic
1059210581 9:112511210-112511232 AACACATTCTCAGATGATACTGG - Intronic
1061486416 9:130922720-130922742 GACACACAGTCGGGAGCTACTGG - Intronic
1189387769 X:40551320-40551342 TGCACATTGTTAGGTGCTGCTGG - Intergenic
1189520179 X:41758605-41758627 GACACATTTCCTGGTGCTCCAGG - Intronic
1190283048 X:48943930-48943952 GACACATTGTCAGGTGCTACAGG - Intronic
1196862119 X:120038409-120038431 GTCACAATGTCAGGTACTGCTGG + Intergenic
1196880983 X:120197935-120197957 GTCACAATGTCAGGTACTGCTGG - Intergenic
1197442039 X:126503536-126503558 GAAACATTGTCATATGCAACAGG - Intergenic
1199009420 X:142741140-142741162 GACACATTTTGAGGTACTAGAGG + Intergenic
1199817652 X:151412945-151412967 GTCACATTCTCAGGTACTAGTGG + Intergenic
1200403893 Y:2789439-2789461 GACACAATGTCAGATGCTTCTGG - Intergenic
1201720633 Y:17093145-17093167 GTCACATTCTGAGGTGCTAGGGG + Intergenic