ID: 1190285289

View in Genome Browser
Species Human (GRCh38)
Location X:48957434-48957456
Sequence GGCGGCGGCGGCACGGGCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2272
Summary {0: 1, 1: 2, 2: 28, 3: 210, 4: 2031}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285289_1190285306 13 Left 1190285289 X:48957434-48957456 CCCACGCCCGTGCCGCCGCCGCC 0: 1
1: 2
2: 28
3: 210
4: 2031
Right 1190285306 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 5
3: 40
4: 410
1190285289_1190285303 11 Left 1190285289 X:48957434-48957456 CCCACGCCCGTGCCGCCGCCGCC 0: 1
1: 2
2: 28
3: 210
4: 2031
Right 1190285303 X:48957468-48957490 CTCCGCCGCGCCGCGGCGCCGGG 0: 1
1: 0
2: 5
3: 29
4: 289
1190285289_1190285304 12 Left 1190285289 X:48957434-48957456 CCCACGCCCGTGCCGCCGCCGCC 0: 1
1: 2
2: 28
3: 210
4: 2031
Right 1190285304 X:48957469-48957491 TCCGCCGCGCCGCGGCGCCGGGG 0: 1
1: 0
2: 3
3: 19
4: 209
1190285289_1190285312 28 Left 1190285289 X:48957434-48957456 CCCACGCCCGTGCCGCCGCCGCC 0: 1
1: 2
2: 28
3: 210
4: 2031
Right 1190285312 X:48957485-48957507 GCCGGGGGCATCGGCCCGGGCGG 0: 1
1: 0
2: 1
3: 19
4: 206
1190285289_1190285311 25 Left 1190285289 X:48957434-48957456 CCCACGCCCGTGCCGCCGCCGCC 0: 1
1: 2
2: 28
3: 210
4: 2031
Right 1190285311 X:48957482-48957504 GGCGCCGGGGGCATCGGCCCGGG 0: 1
1: 0
2: 3
3: 16
4: 264
1190285289_1190285299 4 Left 1190285289 X:48957434-48957456 CCCACGCCCGTGCCGCCGCCGCC 0: 1
1: 2
2: 28
3: 210
4: 2031
Right 1190285299 X:48957461-48957483 CCCACACCTCCGCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 13
4: 160
1190285289_1190285302 10 Left 1190285289 X:48957434-48957456 CCCACGCCCGTGCCGCCGCCGCC 0: 1
1: 2
2: 28
3: 210
4: 2031
Right 1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 36
4: 308
1190285289_1190285308 19 Left 1190285289 X:48957434-48957456 CCCACGCCCGTGCCGCCGCCGCC 0: 1
1: 2
2: 28
3: 210
4: 2031
Right 1190285308 X:48957476-48957498 CGCCGCGGCGCCGGGGGCATCGG 0: 1
1: 0
2: 1
3: 18
4: 169
1190285289_1190285310 24 Left 1190285289 X:48957434-48957456 CCCACGCCCGTGCCGCCGCCGCC 0: 1
1: 2
2: 28
3: 210
4: 2031
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190285289 Original CRISPR GGCGGCGGCGGCACGGGCGT GGG (reversed) Exonic