ID: 1190285293

View in Genome Browser
Species Human (GRCh38)
Location X:48957446-48957468
Sequence GGTGTGGGCGTGGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1841
Summary {0: 1, 1: 0, 2: 7, 3: 141, 4: 1692}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285293_1190285303 -1 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285303 X:48957468-48957490 CTCCGCCGCGCCGCGGCGCCGGG 0: 1
1: 0
2: 5
3: 29
4: 289
1190285293_1190285315 22 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285293_1190285311 13 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285311 X:48957482-48957504 GGCGCCGGGGGCATCGGCCCGGG 0: 1
1: 0
2: 3
3: 16
4: 264
1190285293_1190285306 1 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285306 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 5
3: 40
4: 410
1190285293_1190285304 0 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285304 X:48957469-48957491 TCCGCCGCGCCGCGGCGCCGGGG 0: 1
1: 0
2: 3
3: 19
4: 209
1190285293_1190285317 30 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285317 X:48957499-48957521 CCCGGGCGGCGGCGGCTCGTTGG 0: 1
1: 0
2: 8
3: 37
4: 216
1190285293_1190285299 -8 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285299 X:48957461-48957483 CCCACACCTCCGCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 13
4: 160
1190285293_1190285302 -2 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 36
4: 308
1190285293_1190285314 19 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285314 X:48957488-48957510 GGGGGCATCGGCCCGGGCGGCGG 0: 1
1: 0
2: 0
3: 35
4: 631
1190285293_1190285310 12 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285293_1190285312 16 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285312 X:48957485-48957507 GCCGGGGGCATCGGCCCGGGCGG 0: 1
1: 0
2: 1
3: 19
4: 206
1190285293_1190285308 7 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285308 X:48957476-48957498 CGCCGCGGCGCCGGGGGCATCGG 0: 1
1: 0
2: 1
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190285293 Original CRISPR GGTGTGGGCGTGGGCGGCGG CGG (reversed) Exonic