ID: 1190285296

View in Genome Browser
Species Human (GRCh38)
Location X:48957455-48957477
Sequence CGCGGCGGAGGTGTGGGCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 216}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285296_1190285310 3 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285296_1190285311 4 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285311 X:48957482-48957504 GGCGCCGGGGGCATCGGCCCGGG 0: 1
1: 0
2: 3
3: 16
4: 264
1190285296_1190285319 24 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285319 X:48957502-48957524 GGGCGGCGGCGGCTCGTTGGCGG 0: 1
1: 1
2: 3
3: 30
4: 204
1190285296_1190285315 13 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285296_1190285303 -10 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285303 X:48957468-48957490 CTCCGCCGCGCCGCGGCGCCGGG 0: 1
1: 0
2: 5
3: 29
4: 289
1190285296_1190285322 30 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1190285296_1190285314 10 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285314 X:48957488-48957510 GGGGGCATCGGCCCGGGCGGCGG 0: 1
1: 0
2: 0
3: 35
4: 631
1190285296_1190285308 -2 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285308 X:48957476-48957498 CGCCGCGGCGCCGGGGGCATCGG 0: 1
1: 0
2: 1
3: 18
4: 169
1190285296_1190285312 7 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285312 X:48957485-48957507 GCCGGGGGCATCGGCCCGGGCGG 0: 1
1: 0
2: 1
3: 19
4: 206
1190285296_1190285304 -9 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285304 X:48957469-48957491 TCCGCCGCGCCGCGGCGCCGGGG 0: 1
1: 0
2: 3
3: 19
4: 209
1190285296_1190285306 -8 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285306 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 5
3: 40
4: 410
1190285296_1190285317 21 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285317 X:48957499-48957521 CCCGGGCGGCGGCGGCTCGTTGG 0: 1
1: 0
2: 8
3: 37
4: 216
1190285296_1190285321 26 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285321 X:48957504-48957526 GCGGCGGCGGCTCGTTGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 155
1190285296_1190285320 25 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285320 X:48957503-48957525 GGCGGCGGCGGCTCGTTGGCGGG 0: 1
1: 0
2: 3
3: 22
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190285296 Original CRISPR CGCGGCGGAGGTGTGGGCGT GGG (reversed) Exonic