ID: 1190285297

View in Genome Browser
Species Human (GRCh38)
Location X:48957456-48957478
Sequence GCGCGGCGGAGGTGTGGGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 467}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285297_1190285314 9 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285314 X:48957488-48957510 GGGGGCATCGGCCCGGGCGGCGG 0: 1
1: 0
2: 0
3: 35
4: 631
1190285297_1190285310 2 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285297_1190285315 12 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285297_1190285319 23 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285319 X:48957502-48957524 GGGCGGCGGCGGCTCGTTGGCGG 0: 1
1: 1
2: 3
3: 30
4: 204
1190285297_1190285312 6 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285312 X:48957485-48957507 GCCGGGGGCATCGGCCCGGGCGG 0: 1
1: 0
2: 1
3: 19
4: 206
1190285297_1190285321 25 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285321 X:48957504-48957526 GCGGCGGCGGCTCGTTGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 155
1190285297_1190285320 24 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285320 X:48957503-48957525 GGCGGCGGCGGCTCGTTGGCGGG 0: 1
1: 0
2: 3
3: 22
4: 199
1190285297_1190285311 3 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285311 X:48957482-48957504 GGCGCCGGGGGCATCGGCCCGGG 0: 1
1: 0
2: 3
3: 16
4: 264
1190285297_1190285308 -3 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285308 X:48957476-48957498 CGCCGCGGCGCCGGGGGCATCGG 0: 1
1: 0
2: 1
3: 18
4: 169
1190285297_1190285306 -9 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285306 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 5
3: 40
4: 410
1190285297_1190285322 29 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1190285297_1190285304 -10 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285304 X:48957469-48957491 TCCGCCGCGCCGCGGCGCCGGGG 0: 1
1: 0
2: 3
3: 19
4: 209
1190285297_1190285317 20 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285317 X:48957499-48957521 CCCGGGCGGCGGCGGCTCGTTGG 0: 1
1: 0
2: 8
3: 37
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190285297 Original CRISPR GCGCGGCGGAGGTGTGGGCG TGG (reversed) Exonic