ID: 1190285302

View in Genome Browser
Species Human (GRCh38)
Location X:48957467-48957489
Sequence CCTCCGCCGCGCCGCGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 308}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285295_1190285302 -8 Left 1190285295 X:48957452-48957474 CCGCCCACGCCCACACCTCCGCC 0: 1
1: 1
2: 6
3: 98
4: 1262
Right 1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 36
4: 308
1190285288_1190285302 13 Left 1190285288 X:48957431-48957453 CCGCCCACGCCCGTGCCGCCGCC 0: 1
1: 0
2: 8
3: 80
4: 883
Right 1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 36
4: 308
1190285293_1190285302 -2 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 36
4: 308
1190285291_1190285302 4 Left 1190285291 X:48957440-48957462 CCCGTGCCGCCGCCGCCCACGCC 0: 1
1: 0
2: 24
3: 337
4: 2294
Right 1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 36
4: 308
1190285287_1190285302 16 Left 1190285287 X:48957428-48957450 CCGCCGCCCACGCCCGTGCCGCC 0: 1
1: 0
2: 7
3: 88
4: 824
Right 1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 36
4: 308
1190285289_1190285302 10 Left 1190285289 X:48957434-48957456 CCCACGCCCGTGCCGCCGCCGCC 0: 1
1: 2
2: 28
3: 210
4: 2031
Right 1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 36
4: 308
1190285292_1190285302 3 Left 1190285292 X:48957441-48957463 CCGTGCCGCCGCCGCCCACGCCC 0: 1
1: 0
2: 18
3: 156
4: 1051
Right 1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 36
4: 308
1190285294_1190285302 -5 Left 1190285294 X:48957449-48957471 CCGCCGCCCACGCCCACACCTCC 0: 1
1: 0
2: 8
3: 141
4: 1378
Right 1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 36
4: 308
1190285290_1190285302 9 Left 1190285290 X:48957435-48957457 CCACGCCCGTGCCGCCGCCGCCC 0: 1
1: 1
2: 21
3: 191
4: 1223
Right 1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 36
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190285302 Original CRISPR CCTCCGCCGCGCCGCGGCGC CGG Exonic