ID: 1190285305

View in Genome Browser
Species Human (GRCh38)
Location X:48957470-48957492
Sequence CCCCCGGCGCCGCGGCGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 395}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285305_1190285322 15 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1190285305_1190285323 21 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285323 X:48957514-48957536 CTCGTTGGCGGGGTCGGCGTCGG 0: 1
1: 0
2: 2
3: 4
4: 61
1190285305_1190285320 10 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285320 X:48957503-48957525 GGCGGCGGCGGCTCGTTGGCGGG 0: 1
1: 0
2: 3
3: 22
4: 199
1190285305_1190285325 25 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285325 X:48957518-48957540 TTGGCGGGGTCGGCGTCGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 150
1190285305_1190285315 -2 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285305_1190285312 -8 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285312 X:48957485-48957507 GCCGGGGGCATCGGCCCGGGCGG 0: 1
1: 0
2: 1
3: 19
4: 206
1190285305_1190285321 11 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285321 X:48957504-48957526 GCGGCGGCGGCTCGTTGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 155
1190285305_1190285324 22 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285324 X:48957515-48957537 TCGTTGGCGGGGTCGGCGTCGGG 0: 1
1: 0
2: 1
3: 2
4: 71
1190285305_1190285317 6 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285317 X:48957499-48957521 CCCGGGCGGCGGCGGCTCGTTGG 0: 1
1: 0
2: 8
3: 37
4: 216
1190285305_1190285319 9 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285319 X:48957502-48957524 GGGCGGCGGCGGCTCGTTGGCGG 0: 1
1: 1
2: 3
3: 30
4: 204
1190285305_1190285314 -5 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285314 X:48957488-48957510 GGGGGCATCGGCCCGGGCGGCGG 0: 1
1: 0
2: 0
3: 35
4: 631
1190285305_1190285326 28 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285326 X:48957521-48957543 GCGGGGTCGGCGTCGGGAGGCGG 0: 1
1: 0
2: 2
3: 46
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190285305 Original CRISPR CCCCCGGCGCCGCGGCGCGG CGG (reversed) Exonic