ID: 1190285310

View in Genome Browser
Species Human (GRCh38)
Location X:48957481-48957503
Sequence CGGCGCCGGGGGCATCGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 248}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285295_1190285310 6 Left 1190285295 X:48957452-48957474 CCGCCCACGCCCACACCTCCGCC 0: 1
1: 1
2: 6
3: 98
4: 1262
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285290_1190285310 23 Left 1190285290 X:48957435-48957457 CCACGCCCGTGCCGCCGCCGCCC 0: 1
1: 1
2: 21
3: 191
4: 1223
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285287_1190285310 30 Left 1190285287 X:48957428-48957450 CCGCCGCCCACGCCCGTGCCGCC 0: 1
1: 0
2: 7
3: 88
4: 824
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285298_1190285310 -3 Left 1190285298 X:48957461-48957483 CCCACACCTCCGCCGCGCCGCGG 0: 1
1: 0
2: 1
3: 3
4: 209
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285288_1190285310 27 Left 1190285288 X:48957431-48957453 CCGCCCACGCCCGTGCCGCCGCC 0: 1
1: 0
2: 8
3: 80
4: 883
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285301_1190285310 -9 Left 1190285301 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 4
3: 62
4: 625
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285289_1190285310 24 Left 1190285289 X:48957434-48957456 CCCACGCCCGTGCCGCCGCCGCC 0: 1
1: 2
2: 28
3: 210
4: 2031
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285300_1190285310 -4 Left 1190285300 X:48957462-48957484 CCACACCTCCGCCGCGCCGCGGC 0: 1
1: 0
2: 10
3: 137
4: 421
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285297_1190285310 2 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285293_1190285310 12 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285294_1190285310 9 Left 1190285294 X:48957449-48957471 CCGCCGCCCACGCCCACACCTCC 0: 1
1: 0
2: 8
3: 141
4: 1378
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285296_1190285310 3 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285291_1190285310 18 Left 1190285291 X:48957440-48957462 CCCGTGCCGCCGCCGCCCACGCC 0: 1
1: 0
2: 24
3: 337
4: 2294
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248
1190285292_1190285310 17 Left 1190285292 X:48957441-48957463 CCGTGCCGCCGCCGCCCACGCCC 0: 1
1: 0
2: 18
3: 156
4: 1051
Right 1190285310 X:48957481-48957503 CGGCGCCGGGGGCATCGGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190285310 Original CRISPR CGGCGCCGGGGGCATCGGCC CGG Exonic