ID: 1190285315

View in Genome Browser
Species Human (GRCh38)
Location X:48957491-48957513
Sequence GGCATCGGCCCGGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 891
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 821}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285301_1190285315 1 Left 1190285301 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 4
3: 62
4: 625
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285292_1190285315 27 Left 1190285292 X:48957441-48957463 CCGTGCCGCCGCCGCCCACGCCC 0: 1
1: 0
2: 18
3: 156
4: 1051
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285309_1190285315 -10 Left 1190285309 X:48957478-48957500 CCGCGGCGCCGGGGGCATCGGCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285300_1190285315 6 Left 1190285300 X:48957462-48957484 CCACACCTCCGCCGCGCCGCGGC 0: 1
1: 0
2: 10
3: 137
4: 421
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285297_1190285315 12 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285293_1190285315 22 Left 1190285293 X:48957446-48957468 CCGCCGCCGCCCACGCCCACACC 0: 1
1: 0
2: 7
3: 141
4: 1692
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285305_1190285315 -2 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285307_1190285315 -5 Left 1190285307 X:48957473-48957495 CCGCGCCGCGGCGCCGGGGGCAT 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285294_1190285315 19 Left 1190285294 X:48957449-48957471 CCGCCGCCCACGCCCACACCTCC 0: 1
1: 0
2: 8
3: 141
4: 1378
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285298_1190285315 7 Left 1190285298 X:48957461-48957483 CCCACACCTCCGCCGCGCCGCGG 0: 1
1: 0
2: 1
3: 3
4: 209
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285291_1190285315 28 Left 1190285291 X:48957440-48957462 CCCGTGCCGCCGCCGCCCACGCC 0: 1
1: 0
2: 24
3: 337
4: 2294
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285296_1190285315 13 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821
1190285295_1190285315 16 Left 1190285295 X:48957452-48957474 CCGCCCACGCCCACACCTCCGCC 0: 1
1: 1
2: 6
3: 98
4: 1262
Right 1190285315 X:48957491-48957513 GGCATCGGCCCGGGCGGCGGCGG 0: 1
1: 0
2: 4
3: 65
4: 821

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190285315 Original CRISPR GGCATCGGCCCGGGCGGCGG CGG Exonic