ID: 1190285322

View in Genome Browser
Species Human (GRCh38)
Location X:48957508-48957530
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285309_1190285322 7 Left 1190285309 X:48957478-48957500 CCGCGGCGCCGGGGGCATCGGCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1190285307_1190285322 12 Left 1190285307 X:48957473-48957495 CCGCGCCGCGGCGCCGGGGGCAT 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1190285313_1190285322 -1 Left 1190285313 X:48957486-48957508 CCGGGGGCATCGGCCCGGGCGGC 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1190285305_1190285322 15 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1190285296_1190285322 30 Left 1190285296 X:48957455-48957477 CCCACGCCCACACCTCCGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1190285301_1190285322 18 Left 1190285301 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG 0: 1
1: 0
2: 4
3: 62
4: 625
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1190285298_1190285322 24 Left 1190285298 X:48957461-48957483 CCCACACCTCCGCCGCGCCGCGG 0: 1
1: 0
2: 1
3: 3
4: 209
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1190285297_1190285322 29 Left 1190285297 X:48957456-48957478 CCACGCCCACACCTCCGCCGCGC 0: 1
1: 0
2: 3
3: 51
4: 467
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82
1190285300_1190285322 23 Left 1190285300 X:48957462-48957484 CCACACCTCCGCCGCGCCGCGGC 0: 1
1: 0
2: 10
3: 137
4: 421
Right 1190285322 X:48957508-48957530 CGGCGGCTCGTTGGCGGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type