ID: 1190285326

View in Genome Browser
Species Human (GRCh38)
Location X:48957521-48957543
Sequence GCGGGGTCGGCGTCGGGAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 563}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285309_1190285326 20 Left 1190285309 X:48957478-48957500 CCGCGGCGCCGGGGGCATCGGCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1190285326 X:48957521-48957543 GCGGGGTCGGCGTCGGGAGGCGG 0: 1
1: 0
2: 2
3: 46
4: 563
1190285318_1190285326 -2 Left 1190285318 X:48957500-48957522 CCGGGCGGCGGCGGCTCGTTGGC 0: 1
1: 0
2: 0
3: 17
4: 97
Right 1190285326 X:48957521-48957543 GCGGGGTCGGCGTCGGGAGGCGG 0: 1
1: 0
2: 2
3: 46
4: 563
1190285316_1190285326 -1 Left 1190285316 X:48957499-48957521 CCCGGGCGGCGGCGGCTCGTTGG 0: 1
1: 0
2: 0
3: 20
4: 114
Right 1190285326 X:48957521-48957543 GCGGGGTCGGCGTCGGGAGGCGG 0: 1
1: 0
2: 2
3: 46
4: 563
1190285307_1190285326 25 Left 1190285307 X:48957473-48957495 CCGCGCCGCGGCGCCGGGGGCAT 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1190285326 X:48957521-48957543 GCGGGGTCGGCGTCGGGAGGCGG 0: 1
1: 0
2: 2
3: 46
4: 563
1190285305_1190285326 28 Left 1190285305 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG 0: 1
1: 0
2: 4
3: 50
4: 395
Right 1190285326 X:48957521-48957543 GCGGGGTCGGCGTCGGGAGGCGG 0: 1
1: 0
2: 2
3: 46
4: 563
1190285313_1190285326 12 Left 1190285313 X:48957486-48957508 CCGGGGGCATCGGCCCGGGCGGC 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1190285326 X:48957521-48957543 GCGGGGTCGGCGTCGGGAGGCGG 0: 1
1: 0
2: 2
3: 46
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190285326 Original CRISPR GCGGGGTCGGCGTCGGGAGG CGG Exonic