ID: 1190285417

View in Genome Browser
Species Human (GRCh38)
Location X:48957958-48957980
Sequence GCGCGCGTGCGCAGCGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285417_1190285422 4 Left 1190285417 X:48957958-48957980 CCCGGGGCGCTGCGCACGCGCGC No data
Right 1190285422 X:48957985-48958007 GCACAGCCCCGCCCCTTACTCGG No data
1190285417_1190285426 14 Left 1190285417 X:48957958-48957980 CCCGGGGCGCTGCGCACGCGCGC No data
Right 1190285426 X:48957995-48958017 GCCCCTTACTCGGAAGTACGTGG No data
1190285417_1190285428 15 Left 1190285417 X:48957958-48957980 CCCGGGGCGCTGCGCACGCGCGC No data
Right 1190285428 X:48957996-48958018 CCCCTTACTCGGAAGTACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190285417 Original CRISPR GCGCGCGTGCGCAGCGCCCC GGG (reversed) Intronic