ID: 1190285417

View in Genome Browser
Species Human (GRCh38)
Location X:48957958-48957980
Sequence GCGCGCGTGCGCAGCGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190285417_1190285422 4 Left 1190285417 X:48957958-48957980 CCCGGGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 0
3: 23
4: 147
Right 1190285422 X:48957985-48958007 GCACAGCCCCGCCCCTTACTCGG 0: 1
1: 0
2: 0
3: 12
4: 135
1190285417_1190285428 15 Left 1190285417 X:48957958-48957980 CCCGGGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 0
3: 23
4: 147
Right 1190285428 X:48957996-48958018 CCCCTTACTCGGAAGTACGTGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1190285417_1190285426 14 Left 1190285417 X:48957958-48957980 CCCGGGGCGCTGCGCACGCGCGC 0: 1
1: 1
2: 0
3: 23
4: 147
Right 1190285426 X:48957995-48958017 GCCCCTTACTCGGAAGTACGTGG 0: 1
1: 0
2: 1
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190285417 Original CRISPR GCGCGCGTGCGCAGCGCCCC GGG (reversed) Intronic
900458653 1:2789765-2789787 GCGCGCGCACACAGCCCCCCGGG + Intronic
900984477 1:6065548-6065570 GCGGCCCTGCGCAGCCCCCCAGG + Intronic
903044167 1:20553340-20553362 CCGTGCGAGCGCAGCGCCGCCGG + Exonic
904165589 1:28552963-28552985 GCTCCCGAGCGCAGCGGCCCGGG - Intergenic
904794773 1:33051091-33051113 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
905670910 1:39789271-39789293 GTGAGCCTGGGCAGCGCCCCAGG + Intergenic
906436877 1:45803817-45803839 GCGCGGCTGCGCTGCGGCCCGGG + Exonic
906486604 1:46240252-46240274 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
907012692 1:50978110-50978132 GGCCGCCGGCGCAGCGCCCCGGG + Intergenic
909608757 1:77532042-77532064 AGGCGCGTGCGCAGAGCTCCAGG - Intronic
912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG + Intronic
912800163 1:112715236-112715258 GCGCGGAGGCGGAGCGCCCCCGG + Exonic
921089519 1:211830278-211830300 GCCCGCTCGCGCAGCGCCTCGGG - Intronic
921384073 1:214551822-214551844 GCGCGCGCCCGCGGCGCCCCCGG - Intronic
921781730 1:219173772-219173794 GCGCGCATGCGCAGCGCTGCTGG - Intergenic
922602948 1:226870797-226870819 CCCTGCGTGCGCAGCGCTCCTGG + Intronic
923092239 1:230749455-230749477 GGGCGCGTGGGCAGCTGCCCAGG + Intronic
923506416 1:234609668-234609690 CGGCGCCCGCGCAGCGCCCCCGG + Intergenic
924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG + Intronic
1065636675 10:27742258-27742280 GTGAGGGAGCGCAGCGCCCCAGG - Intronic
1067344430 10:45427549-45427571 GCGCCCGCGCGCAGGACCCCCGG - Intronic
1069703054 10:70440440-70440462 GCGCGGGAGCGAAGGGCCCCCGG + Intronic
1070152070 10:73811343-73811365 CCCAGCGTGCGCCGCGCCCCGGG - Intronic
1070768135 10:79068131-79068153 GCCCGCGCGCACAGCGCCCCGGG + Intergenic
1072950172 10:99840350-99840372 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1073503841 10:103967036-103967058 GCGCGCGTGCGCGGGGCCAGAGG + Intergenic
1076356087 10:129854878-129854900 GCCCCCGCGGGCAGCGCCCCTGG - Intronic
1076792902 10:132786186-132786208 CAGCGCGCGCGCCGCGCCCCGGG - Intergenic
1077010226 11:376352-376374 GTGAGTGTCCGCAGCGCCCCTGG + Intronic
1077074940 11:696052-696074 GCGCGCGGGCGCCTGGCCCCGGG + Intronic
1077101540 11:824713-824735 GCGCGCATGCGCAGAGCTTCGGG - Exonic
1084621065 11:70270641-70270663 GCGAGCGTCAGCACCGCCCCGGG - Intergenic
1085396789 11:76210474-76210496 GCGCGCCTGGCGAGCGCCCCGGG - Intronic
1087782637 11:102317631-102317653 GCGCGCGCGCGCGCCTCCCCTGG + Intronic
1091460880 12:642900-642922 GCGCGAGGGCGCAGGGCCCGCGG - Intronic
1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG + Intergenic
1094844039 12:34353703-34353725 GCGTGCATGCGCAGTGCCCAGGG - Intergenic
1094856493 12:34405220-34405242 CCGCTCATGCGCAGGGCCCCAGG + Intergenic
1095439296 12:42226950-42226972 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1096782784 12:54000624-54000646 GCGCGGTCGCGCAGCTCCCCGGG - Exonic
1097794057 12:63843970-63843992 GCACGCGGGAGCCGCGCCCCCGG - Intergenic
1102197124 12:111033910-111033932 GGGCGCGGGCGGAGCGCGCCGGG - Intergenic
1102884101 12:116508676-116508698 GCGCGCCTGAGCAGCGGCCCTGG - Intergenic
1103597903 12:122035259-122035281 GCACACGTGCTCAGAGCCCCTGG - Intronic
1103698666 12:122836000-122836022 GTGCGCGAGCCCAGCGCGCCGGG + Intronic
1104961460 12:132490277-132490299 GCGCGCATGGGGCGCGCCCCCGG + Exonic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1112051122 13:95644447-95644469 GCCCGCGTCAGCAGCGACCCTGG - Intronic
1112589102 13:100747716-100747738 GCGTGTGTGCGCAGCAGCCCCGG - Intergenic
1117131980 14:52695766-52695788 GGGCGCGGGCGCAGCGGACCGGG - Intronic
1122964070 14:105112920-105112942 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1123033929 14:105464165-105464187 GCGGGCGTGCGGTGTGCCCCCGG - Intronic
1123630743 15:22258206-22258228 GCGCGCGGGCGCCGCGGGCCGGG - Intergenic
1124618025 15:31256585-31256607 GCGGGTGTGGGCAGCGACCCTGG - Intergenic
1128161099 15:65423118-65423140 GCGCGCGGGCGCAGGGTCCCCGG - Intergenic
1129644845 15:77420250-77420272 GCGCGCGTGCTCACGGCTCCAGG - Intergenic
1132314262 15:100879296-100879318 GGGCACGTGCGCAGCGACGCGGG + Intronic
1132560781 16:592648-592670 CTGGGAGTGCGCAGCGCCCCTGG - Intronic
1132849852 16:2020099-2020121 GCGCGCGGCCGCCGGGCCCCTGG + Exonic
1133021636 16:2969484-2969506 TCGCGCGTGCGCAGCGCCGGAGG + Exonic
1133038286 16:3046593-3046615 GGCCGCTGGCGCAGCGCCCCGGG + Intergenic
1133340664 16:5033668-5033690 GCGCGCGCGCGCGCCTCCCCCGG - Exonic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134707182 16:16310783-16310805 GCTGGCGTCCGCAGAGCCCCCGG - Intergenic
1134960359 16:18401342-18401364 GCTGGCGTCCGCAGAGCCCCCGG + Intergenic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1135614697 16:23901166-23901188 GCTCACGTGCTCAGAGCCCCAGG - Intronic
1136037216 16:27549618-27549640 GCGGGCGGGCGCAGGGCCCGGGG - Intronic
1136245798 16:28975126-28975148 GCGGGCGGGCGCGGCCCCCCGGG + Exonic
1136477701 16:30523962-30523984 GTGTGCGTGCACAGCGCCCTGGG - Intergenic
1136505184 16:30698561-30698583 GGGTGCGCGCGCAGCACCCCGGG - Intronic
1137300252 16:47142980-47143002 GCGCGCGGGCGCCGCGGACCCGG - Intronic
1138327941 16:56191244-56191266 GCGCGTGTGCGCGCCGCCGCCGG + Intergenic
1139890642 16:70251474-70251496 GCGCGCGCGGGTAGCGGCCCAGG + Exonic
1139952205 16:70677944-70677966 GCCCGCCTGCCCAGCGCCCCTGG + Intronic
1141502503 16:84453558-84453580 GGGCGCGTGGGCAGCTCCCTTGG + Intronic
1141972302 16:87492367-87492389 GCGCGCGGGCGCCGCGGGCCGGG + Intergenic
1142549915 17:732344-732366 ACGCGCGCGCGCCGCGGCCCCGG + Intergenic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143510977 17:7394787-7394809 GCGTGCGTGCTCAGCGCCCTGGG + Exonic
1144787472 17:17840106-17840128 GCGCGCGTGCGGAGCCGCCCCGG - Intergenic
1145265220 17:21376692-21376714 GCGCGCCTGGACGGCGCCCCCGG - Exonic
1147963136 17:44179794-44179816 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1148579374 17:48733219-48733241 GAGCGCGGCCGCCGCGCCCCCGG + Intergenic
1151370709 17:73644775-73644797 GCGCCCGGCCCCAGCGCCCCCGG - Intergenic
1152426452 17:80220845-80220867 GCGCGCGGGCGCCGGGGCCCTGG + Intronic
1152628500 17:81399324-81399346 GCGTGCGCGCGCGGGGCCCCGGG + Intronic
1152751802 17:82065726-82065748 GCGGGCGTTCGCGGCGCCCCGGG - Intronic
1152834365 17:82519849-82519871 GCGCCCGCGCGGAGCGGCCCGGG + Exonic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1154210774 18:12377106-12377128 CCGCGCCTGCGCAGCGTCCCGGG - Exonic
1160204503 18:76822283-76822305 GGGCGCATGCGCGGCGCCGCGGG - Exonic
1160452399 18:78974316-78974338 GTGCGCGTGCGAAGGGTCCCAGG - Intergenic
1160952110 19:1672510-1672532 GCGCACGTGGGGAGCGCCCGCGG - Intergenic
1161521045 19:4723655-4723677 GCGCGCGGGCGCTGCTCACCGGG + Exonic
1162398788 19:10432437-10432459 GCGCTCCGGTGCAGCGCCCCGGG + Intronic
1162886642 19:13702551-13702573 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG + Exonic
1163063610 19:14776965-14776987 GTGTGTGTGTGCAGCGCCCCTGG - Intronic
1163713511 19:18860979-18861001 GCCCGAGGGCGCAGCGCACCTGG - Exonic
1164191861 19:22925298-22925320 GCGCGGCTGCGCTGCGGCCCAGG + Intergenic
1164653388 19:29901926-29901948 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG + Exonic
1166261380 19:41643977-41643999 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1167071906 19:47226691-47226713 TCGCCCGTGCCCAGCGCCCCGGG - Exonic
1167347322 19:48954869-48954891 GCGGGCGGCCGCAGCGCGCCCGG - Intronic
1167371485 19:49085328-49085350 TCGCGCGTGCGCTGTGCCCGCGG + Intergenic
1167469961 19:49670172-49670194 GTCCGCGTCAGCAGCGCCCCCGG - Intronic
1168351029 19:55675491-55675513 GCCCGCGCGCGCCGCGGCCCAGG - Intronic
924987692 2:287357-287379 GCGCGCGTGAGCTGCGGCGCGGG - Intronic
931348727 2:61470516-61470538 GCGTGCGGGCCTAGCGCCCCGGG - Intronic
936433243 2:112482180-112482202 GCGCCCGGGCGCGGCGCCGCCGG + Exonic
938402639 2:131005696-131005718 GCGGGAGTGCCCAGCGCCCCAGG + Intronic
1170924799 20:20712743-20712765 GTGCGCGTGCGTAGCGCCCAAGG - Intergenic
1172118385 20:32584381-32584403 GCTCGCCTGGGCAGCGCTCCGGG - Intronic
1172409049 20:34709093-34709115 CAGCCCGTCCGCAGCGCCCCGGG - Intronic
1173488374 20:43458156-43458178 GCGCCCGCGCCCAGCGTCCCAGG + Intronic
1176084041 20:63287884-63287906 GCCCCCGTCCCCAGCGCCCCCGG + Exonic
1176159806 20:63642317-63642339 GCGCGCGTGAGCGGCAACCCCGG + Intronic
1176194575 20:63831304-63831326 GCGCGCGCGCGCCCCGCCCGCGG + Intergenic
1181270787 22:21657497-21657519 GCGCGCGTGCCCAGAGCAACGGG + Intronic
1181831609 22:25564784-25564806 GCGCGCGTGCGCGGGGCGCCGGG + Intergenic
1183093685 22:35540314-35540336 GTGCGCGCGCCCAGCGGCCCCGG + Intergenic
1183788408 22:40045217-40045239 GAGCGCGCGCTCAGCGCCGCCGG - Intronic
1184276579 22:43412249-43412271 GCGCCCCTGCGCAGCGCCGCGGG - Intronic
950282558 3:11720036-11720058 GCGCGCGTGGGGAGCGCGGCGGG - Intronic
952945814 3:38477369-38477391 GCTCGCCTTCGCAGCGCTCCAGG - Exonic
953886615 3:46717780-46717802 TCGCGCGCGGGCAGCGCCCCCGG - Exonic
965590559 3:170357377-170357399 GCGCGCGTGCCCCTCCCCCCAGG - Intergenic
972960642 4:44448403-44448425 GCGAGGGTGCGCAGGGCCCCGGG + Exonic
978189472 4:105895616-105895638 GCGCCACTGCGCTGCGCCCCAGG + Exonic
982746008 4:159104063-159104085 GCGGGCGGGCGCAGCGCGCAGGG + Intergenic
985986162 5:3518336-3518358 GTGCGCGTGCACACCGCCACGGG + Intergenic
987050417 5:14143590-14143612 GCGCGCGGACGCAGAGCCCCGGG - Intergenic
987099805 5:14581871-14581893 GCGCCCGTCCGCAGCGCGGCCGG + Exonic
992373664 5:76170851-76170873 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
999374945 5:151080653-151080675 GCGCGCGTGCGCACTGCGCGGGG - Intronic
1000985194 5:167858621-167858643 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1002341468 5:178519027-178519049 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1003624200 6:7727479-7727501 GAGCGGGTGCGCGGCGCCCGGGG - Exonic
1007674483 6:43581777-43581799 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1015476483 6:133664081-133664103 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1019297889 7:288781-288803 GCAGGCGGGCTCAGCGCCCCTGG - Intergenic
1022207490 7:28179442-28179464 GGCGGCCTGCGCAGCGCCCCGGG - Intronic
1024255393 7:47536977-47536999 GCGCCCGTGCCTCGCGCCCCTGG + Intronic
1025032831 7:55571879-55571901 CCGCGCCTGCGCCGCGCCCGAGG + Intronic
1026665471 7:72336904-72336926 GCGCGCGTGGGGAGCGGCCCGGG - Intronic
1030048962 7:105521764-105521786 GCGCTCGGGCGCGGCGCCTCCGG + Intronic
1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG + Intergenic
1035709436 8:1701112-1701134 GCTCGCGAGCTCAGCGGCCCTGG - Intronic
1036454256 8:8893580-8893602 GAGCGCGGGCGCCGCGTCCCCGG + Exonic
1040079386 8:43271984-43272006 TTGCGCCTGCGCAGCGTCCCGGG - Intergenic
1043502980 8:80874402-80874424 GCGCGCGGGCGCAGCCGGCCGGG - Intronic
1049752522 8:144291884-144291906 GCGCGCGGGCGCGGGGCCCGTGG + Intronic
1053457017 9:38241342-38241364 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1053643676 9:40109347-40109369 CAGCGCTTGCGCTGCGCCCCAGG + Intergenic
1053762477 9:41356143-41356165 CAGCGCTTGCGCTGCGCCCCAGG - Intergenic
1054324531 9:63706578-63706600 CAGCGCTTGCGCTGCGCCCCAGG + Intergenic
1054541074 9:66267260-66267282 CAGCGCTTGCGCTGCGCCCCAGG - Intergenic
1057900387 9:98943817-98943839 GCGTGAGTGCGCAGCGCGCGGGG + Exonic
1059210809 9:112513502-112513524 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060064729 9:120494855-120494877 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1061321726 9:129835251-129835273 GCGCCTCTGCGCAGCGGCCCAGG + Exonic
1061575342 9:131502861-131502883 ACGCGCGTGCGCAGCGGGCGAGG - Intergenic
1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG + Intergenic
1062653610 9:137590681-137590703 GCGCGCGCAGGCACCGCCCCCGG - Intergenic
1185505778 X:631415-631437 GCGCGCGTGGGCACCGACACGGG + Intronic
1189473927 X:41334632-41334654 GCGGGAGTGCGCAGCGCGGCGGG + Intronic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic
1199760121 X:150898711-150898733 GCGCGCGCGCGGCGCGGCCCCGG + Intronic
1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG + Intronic