ID: 1190287214

View in Genome Browser
Species Human (GRCh38)
Location X:48969694-48969716
Sequence CTCGTTTTCTACTATGTGAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190287214_1190287218 -2 Left 1190287214 X:48969694-48969716 CCGGTCACATAGTAGAAAACGAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1190287218 X:48969715-48969737 AGGGCTGCGGTGCTCGTGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1190287214_1190287219 9 Left 1190287214 X:48969694-48969716 CCGGTCACATAGTAGAAAACGAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1190287219 X:48969726-48969748 GCTCGTGTGTGGATTCTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190287214 Original CRISPR CTCGTTTTCTACTATGTGAC CGG (reversed) Exonic
900830477 1:4961750-4961772 CTCTTTTTCTTATATGTGAGTGG - Intergenic
905113289 1:35614048-35614070 CTGCTTTTCTACCATGTGTCAGG - Intronic
907329994 1:53664555-53664577 CTCAGCTTCTACTATGTGCCAGG + Intronic
908090469 1:60680180-60680202 ATGGTTTTTTACTATGTGCCAGG + Intergenic
911258580 1:95661114-95661136 ATTGTTTTCTACAATGTGATAGG - Intergenic
912715681 1:111982158-111982180 CTGGTCTTCTACTACGTGACTGG - Exonic
920348755 1:205323593-205323615 CTCTTTATCTCCTTTGTGACTGG + Intergenic
922826938 1:228528202-228528224 CTCGTTTAGTACAATGGGACAGG - Intergenic
1066403037 10:35093233-35093255 CTCCAGTTCTCCTATGTGACTGG + Intergenic
1069747211 10:70723262-70723284 CTCTGTTTCTTCTCTGTGACAGG - Intronic
1073036627 10:100568211-100568233 CTCGTGCTCTGCTATCTGACTGG + Intergenic
1073810449 10:107146969-107146991 CTGGGTTTTTACTATGTGCCAGG - Intronic
1075315393 10:121449011-121449033 CTCGTTTTCCACCATGAGAGTGG - Intergenic
1080077035 11:28161598-28161620 CTCATTTTCTTCAATTTGACAGG - Intronic
1080123979 11:28709814-28709836 CTGATTTTCTACTTTGTGTCAGG + Intergenic
1081258346 11:40925793-40925815 CTGGAATTCTACTATGTGCCAGG + Intronic
1081301856 11:41462257-41462279 CTTGATTTGTACTATGTGTCTGG + Intergenic
1082120969 11:48379300-48379322 CTAATCTTCTACTATGTGAATGG + Intergenic
1086434456 11:86767599-86767621 CTGATTATCTACTATGTGCCAGG - Intergenic
1088810650 11:113389416-113389438 CTGCTCTTCTACTATGTGTCAGG + Intronic
1089710137 11:120308609-120308631 CTCATTTTCTGCTTTGAGACAGG + Intronic
1090686222 11:129123858-129123880 CTGGTTTTCTACTTTGTGTTGGG - Intronic
1093499356 12:19794517-19794539 CTCTTTTTCTATAATGTCACTGG - Intergenic
1094270177 12:28605423-28605445 CTGAGCTTCTACTATGTGACAGG + Intergenic
1094670750 12:32566483-32566505 CTGGTTATGTACTATGTGAGCGG - Intronic
1095403412 12:41840887-41840909 CTCATTTTCTCCTATGTTCCAGG + Intergenic
1096886948 12:54727462-54727484 GTTATTTTCTACTATGTGGCTGG + Intergenic
1100215106 12:92439501-92439523 CTGGTTTTCCCCTATGTGAAAGG - Intergenic
1103064192 12:117883364-117883386 TTCGTCATCTACTATGTGCCAGG - Intronic
1103112879 12:118296986-118297008 CTCAGTTTCTACTATGTGTATGG + Intronic
1105170429 13:17581674-17581696 AGAGTTTTCAACTATGTGACTGG - Intergenic
1109240814 13:59885326-59885348 CTGGTTTTCTACGATGGGATGGG - Intronic
1111451638 13:88426689-88426711 CTCCTTTTCTAATATCTCACAGG - Intergenic
1114784005 14:25573028-25573050 CTGGTTTTCTATCATATGACAGG + Intergenic
1116374922 14:44186613-44186635 TTCTTTCTCTACTATGTGAAAGG - Intergenic
1124438198 15:29668287-29668309 CTCCTTTTCTGCTTTGTGATTGG - Intergenic
1127618347 15:60709248-60709270 CTGAGTTTCTACTATGTGCCTGG + Intronic
1130667427 15:85881472-85881494 CTCGTGTTCTACTGTCTTACGGG + Intergenic
1130950602 15:88584005-88584027 CTCTTTTCCTACTATGTGTGTGG + Intergenic
1133445594 16:5858333-5858355 CGTGTTTTCTACCATGTGTCAGG + Intergenic
1149817629 17:59741957-59741979 CTGGTTTTTTACTGAGTGACTGG + Intronic
1150232083 17:63560049-63560071 CTCTTTTTCTACTGGGTGACTGG - Intronic
1151430939 17:74062563-74062585 TTCTTTTTCCTCTATGTGACTGG - Intergenic
1153943746 18:10000244-10000266 CTAGTTTTATACTATGTGGTTGG - Intergenic
1155527342 18:26730673-26730695 CTCATTTGCTACTAGGTGCCGGG - Intergenic
1157001207 18:43527776-43527798 CATGTTTTGTACCATGTGACTGG - Intergenic
926733309 2:16053873-16053895 CTCGTGTTCTAATATGTAAGAGG + Intergenic
930607856 2:53510896-53510918 CTCGTTTTGTATTATGTGTTTGG - Intergenic
934628552 2:95888236-95888258 GATGTTTTCTACTTTGTGACTGG + Intronic
935848811 2:107196399-107196421 CTGGTTTTCATCTATATGACTGG - Intergenic
942495591 2:176536668-176536690 CTCCTTTTATACTCTGTCACTGG + Intergenic
944006649 2:194916906-194916928 CTAGTTTTAGACTAAGTGACAGG - Intergenic
1173956467 20:47036841-47036863 CCAGTTATCAACTATGTGACAGG + Intronic
1174715736 20:52756361-52756383 CTAAGTTTCTACTATGTGCCTGG + Intergenic
1175080363 20:56414996-56415018 CTCGTTTCCTCGTCTGTGACAGG - Intronic
1175313742 20:58030801-58030823 TTCGTTTTCTACTATGTTGAGGG - Intergenic
1176158077 20:63632991-63633013 CTCGTTTTCTTTTACATGACAGG - Intergenic
1181880471 22:25975450-25975472 CTGTATGTCTACTATGTGACAGG + Intronic
1182833579 22:33323310-33323332 CTGGGTACCTACTATGTGACTGG + Intronic
956293095 3:67682346-67682368 CTGAGTGTCTACTATGTGACAGG - Intergenic
957573821 3:81984144-81984166 CTCAATTTCTACTATGTGTCAGG - Intergenic
959786302 3:110302695-110302717 CTCATTTTCTTCTTTGAGACAGG + Intergenic
964039274 3:152239284-152239306 CTTATTTTCTTCTATGTGATAGG + Intergenic
965327384 3:167323905-167323927 CTCATTTCCTTCTATGTGAAAGG - Intronic
973008112 4:45038878-45038900 CTGGGTATCTACTATGTGGCAGG + Intergenic
973280494 4:48355254-48355276 TTCCTTTTCTACTGTGTGCCAGG + Intronic
973804507 4:54512840-54512862 ATTGTTGTCTACTATGTGCCAGG + Intergenic
974885851 4:67816204-67816226 CTCATTTTCTATTATGTTATTGG + Intergenic
976141341 4:81995653-81995675 ATAGTTATCTACTATGTGACTGG + Intronic
976191751 4:82493950-82493972 CTGGGTTGCTACTATGTGCCAGG + Intronic
978197936 4:105992016-105992038 CTCGTTATCTACTTTATCACAGG + Intronic
982272680 4:153607463-153607485 CACGTTGTCTCCTGTGTGACTGG + Intronic
987544793 5:19300554-19300576 ACAGTTTTCTACTAGGTGACAGG + Intergenic
990737617 5:58881091-58881113 CTAGGTATCTACTATGTGCCAGG + Intergenic
1000491898 5:161924370-161924392 CTAGTTTCTTACTATGTGTCAGG + Intergenic
1000858058 5:166424469-166424491 CTCATTGCCTACTATGTGTCAGG + Intergenic
1006580967 6:35077868-35077890 CTCCTTTCTTACTATATGACAGG - Intronic
1011328397 6:86175691-86175713 AATGTTTTCTACTATGTGAAGGG + Intergenic
1027154477 7:75756821-75756843 GTCGTTTTTTCCTATGAGACAGG + Intergenic
1028702422 7:93795525-93795547 CTCCTTTTCTCCTTTGTGAAAGG + Intronic
1029817800 7:103114382-103114404 CTCGGTGTCTGCTATGTGCCAGG - Intronic
1029947789 7:104551635-104551657 CTGGTTTTCCACTCTGTCACTGG - Intronic
1031317594 7:120275185-120275207 CTGGTGTTCTACTATGTCACGGG + Exonic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1038249811 8:25892763-25892785 CTGTGTTTCTAATATGTGACAGG + Intronic
1038560558 8:28575416-28575438 CTGATTATCTACTATGTGCCAGG + Intergenic
1048685803 8:136904288-136904310 CTAGGTGTCTACTATGTGACAGG + Intergenic
1051135893 9:13919941-13919963 TTGGGTTTCTACTATGTGTCAGG - Intergenic
1051219143 9:14830396-14830418 CTAGTTTTCTACTGTTTGCCTGG + Intronic
1055262490 9:74454089-74454111 CTGGTTTTATATTATGTGCCAGG + Intergenic
1057785964 9:98087573-98087595 CTCGCCTTCTACGACGTGACGGG - Exonic
1061076363 9:128343793-128343815 CTTGTTCTCTACTAGGTGCCAGG + Intronic
1187958928 X:24549245-24549267 CTCCTTTTCTCCTAGGTGCCTGG + Intergenic
1189563861 X:42219125-42219147 CTGGTGTTCTACTATCTCACAGG + Intergenic
1190287214 X:48969694-48969716 CTCGTTTTCTACTATGTGACCGG - Exonic
1195645174 X:107222675-107222697 CTAGTTTTCTTTTCTGTGACAGG + Intronic
1197786159 X:130199385-130199407 CTCTTTTTCTACCCTGTGGCAGG + Intergenic
1202139830 Y:21710125-21710147 TGCGTTTTCTACTATGAGGCTGG + Intergenic