ID: 1190287878

View in Genome Browser
Species Human (GRCh38)
Location X:48972462-48972484
Sequence GAGACTACCCCCTCGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190287878_1190287887 29 Left 1190287878 X:48972462-48972484 CCCCACTCCGAGGGGGTAGTCTC No data
Right 1190287887 X:48972514-48972536 ATCACACCTCCTCCGCTAGAGGG No data
1190287878_1190287882 0 Left 1190287878 X:48972462-48972484 CCCCACTCCGAGGGGGTAGTCTC No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287878_1190287886 28 Left 1190287878 X:48972462-48972484 CCCCACTCCGAGGGGGTAGTCTC No data
Right 1190287886 X:48972513-48972535 AATCACACCTCCTCCGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190287878 Original CRISPR GAGACTACCCCCTCGGAGTG GGG (reversed) Intergenic
No off target data available for this crispr