ID: 1190287882

View in Genome Browser
Species Human (GRCh38)
Location X:48972485-48972507
Sequence TCTTATCTGTCCATATCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190287870_1190287882 20 Left 1190287870 X:48972442-48972464 CCCCTACCATCTCAGGCAGGCCC No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287873_1190287882 14 Left 1190287873 X:48972448-48972470 CCATCTCAGGCAGGCCCCACTCC No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287868_1190287882 22 Left 1190287868 X:48972440-48972462 CCCCCCTACCATCTCAGGCAGGC No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287872_1190287882 18 Left 1190287872 X:48972444-48972466 CCTACCATCTCAGGCAGGCCCCA No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287871_1190287882 19 Left 1190287871 X:48972443-48972465 CCCTACCATCTCAGGCAGGCCCC No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287869_1190287882 21 Left 1190287869 X:48972441-48972463 CCCCCTACCATCTCAGGCAGGCC No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287881_1190287882 -7 Left 1190287881 X:48972469-48972491 CCGAGGGGGTAGTCTCTCTTATC No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287879_1190287882 -1 Left 1190287879 X:48972463-48972485 CCCACTCCGAGGGGGTAGTCTCT No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287866_1190287882 25 Left 1190287866 X:48972437-48972459 CCACCCCCCTACCATCTCAGGCA No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287878_1190287882 0 Left 1190287878 X:48972462-48972484 CCCCACTCCGAGGGGGTAGTCTC No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287865_1190287882 26 Left 1190287865 X:48972436-48972458 CCCACCCCCCTACCATCTCAGGC No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data
1190287880_1190287882 -2 Left 1190287880 X:48972464-48972486 CCACTCCGAGGGGGTAGTCTCTC No data
Right 1190287882 X:48972485-48972507 TCTTATCTGTCCATATCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190287882 Original CRISPR TCTTATCTGTCCATATCCAG TGG Intergenic
No off target data available for this crispr